EMAIL THIS PAGE TO A FRIEND

DUSP5

dual specificity phosphatase 5

164 Gene Product Result for
Synonyms: DUSP HVH3
UniProtKB ID: Q16690, Q12997, Q5T603
Gene ID:
Human(1847) Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, is expressed in a variety of tissues with the highest levels in pancreas and brain, and is localized in the nucleus. [provided by RefSeq, Jul 2008]
Mouse(240672) dual specificity phosphatase 5
Rat(171109) dual specificity phosphatase 5
sheep(101118748) dual specificity phosphatase 5
Domestic Rabbit(100343162) dual specificity phosphatase 5
domestic guinea pig(100729004) dual specificity phosphatase 5
naked mole-rat(101726329) dual specificity phosphatase 5
Zebrafish(114436) dual specificity phosphatase 5
cow(507061) dual specificity phosphatase 5
domestic cat(101098828) dual specificity phosphatase 5
dog(486884) dual specificity phosphatase 5
chicken(423890) dual specificity phosphatase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_140740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_140740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_140740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004419 Rosetta Predictions human pricing
NM_133578 Rosetta Predictions rat pricing
NM_001085390 Rosetta Predictions mouse pricing
XM_140740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188900 predicted 786
2 SASI_Hs01_00188901 predicted 1461
3 SASI_Hs02_00337568 predicted 1475
4 SASI_Hs01_00188904 predicted 1074
5 SASI_Hs01_00188905 predicted 1294
6 SASI_Hs02_00337569 predicted 1259
7 SASI_Hs01_00188907 predicted 1517
8 SASI_Hs01_00188908 predicted 1606
9 SASI_Hs02_00337570 predicted 1253
10 SASI_Hs02_00337571 predicted 874
11 SASI_Hs01_00188902 predicted 968
12 SASI_Hs01_00188903 predicted 1272
13 SASI_Hs01_00188906 predicted 1771
14 SASI_Hs01_00188909 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087948 predicted 1628
2 SASI_Rn01_00087949 predicted 707
3 SASI_Rn01_00087950 predicted 1643
4 SASI_Rn02_00267775 predicted 1183
5 SASI_Rn02_00267776 predicted 663
6 SASI_Rn01_00087951 predicted 1352
7 SASI_Rn01_00087952 predicted 1391
8 SASI_Rn01_00087954 predicted 1204
9 SASI_Rn01_00087955 predicted 891
10 SASI_Rn01_00087956 predicted 1718
11 SASI_Rn01_00087953 predicted 1606
12 SASI_Rn01_00087957 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300305 predicted 712
2 SASI_Mm02_00300306 predicted 600
3 SASI_Mm02_00300307 predicted 851
4 SASI_Mm02_00300308 predicted 465
5 SASI_Mm02_00300309 predicted 865
6 SASI_Mm02_00300310 predicted 880
7 SASI_Mm02_00300311 predicted 704
8 SASI_Mm02_00300312 predicted 380
9 SASI_Mm02_00300313 predicted 380
10 SASI_Mm02_00300314 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262935 predicted 1010
2 SASI_Mm01_00262936 predicted 1147
3 SASI_Mm01_00262937 predicted 752
4 SASI_Mm01_00262938 predicted 1152
5 SASI_Mm01_00262939 predicted 1174
6 SASI_Mm01_00262940 predicted 995
7 SASI_Mm01_00262941 predicted 1807
8 SASI_Mm01_00262942 predicted 670
9 SASI_Mm01_00262943 predicted 1207
10 SASI_Mm01_00262944 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004419
VALIDATED
DUSP5 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004419.x-620s1c1
Sequence:CCGGCTGAGTGTTGCGTGGATGTAACTCGAGTTACATCCACGCAACACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004419.x-2213s1c1
Sequence:CCGGCCTGTCCTTCTGTGTGCTTATCTCGAGATAAGCACACAGAAGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004419.x-1014s1c1
Sequence:CCGGCCGTTCACCCACCATCTGCATCTCGAGATGCAGATGGTGGGTGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004419.x-1224s1c1
Sequence:CCGGGATAGGCCATTTGCAGACACTCTCGAGAGTGTCTGCAAATGGCCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004419.x-869s1c1
Sequence:CCGGTGACCCACCTACACTACAAATCTCGAGATTTGTAGTGTAGGTGGGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004419.3-1391s21c1
Sequence:CCGGCAACGGCCACATCCTGCTAAACTCGAGTTTAGCAGGATGTGGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-1180s21c1
Sequence:CCGGCAGCTCCTGCAGTACGAATCTCTCGAGAGATTCGTACTGCAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-1147s21c1
Sequence:CCGGAGCATGGTCTCGCCCAACTTTCTCGAGAAAGTTGGGCGAGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-915s21c1
Sequence:CCGGGACCCACCTACACTACAAATGCTCGAGCATTTGTAGTGTAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004419.3-643s21c1
Sequence:CCGGGAGACTTTCTACTCGGAATATCTCGAGATATTCCGAGTAGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004419.3-666s21c1
Sequence:CCGGTGAGTGTTGCGTGGATGTAAACTCGAGTTTACATCCACGCAACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-1112s21c1
Sequence:CCGGTGAAGGAGGCCTTCGATTACACTCGAGTGTAATCGAAGGCCTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004419
VALIDATED
DUSP5 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004419.x-620s1c1
Sequence:CCGGCTGAGTGTTGCGTGGATGTAACTCGAGTTACATCCACGCAACACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004419.x-2213s1c1
Sequence:CCGGCCTGTCCTTCTGTGTGCTTATCTCGAGATAAGCACACAGAAGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004419.x-1014s1c1
Sequence:CCGGCCGTTCACCCACCATCTGCATCTCGAGATGCAGATGGTGGGTGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004419.x-1224s1c1
Sequence:CCGGGATAGGCCATTTGCAGACACTCTCGAGAGTGTCTGCAAATGGCCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004419.x-869s1c1
Sequence:CCGGTGACCCACCTACACTACAAATCTCGAGATTTGTAGTGTAGGTGGGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004419.3-1391s21c1
Sequence:CCGGCAACGGCCACATCCTGCTAAACTCGAGTTTAGCAGGATGTGGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-1180s21c1
Sequence:CCGGCAGCTCCTGCAGTACGAATCTCTCGAGAGATTCGTACTGCAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-1147s21c1
Sequence:CCGGAGCATGGTCTCGCCCAACTTTCTCGAGAAAGTTGGGCGAGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-915s21c1
Sequence:CCGGGACCCACCTACACTACAAATGCTCGAGCATTTGTAGTGTAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004419.3-643s21c1
Sequence:CCGGGAGACTTTCTACTCGGAATATCTCGAGATATTCCGAGTAGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004419.3-666s21c1
Sequence:CCGGTGAGTGTTGCGTGGATGTAAACTCGAGTTTACATCCACGCAACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-1112s21c1
Sequence:CCGGTGAAGGAGGCCTTCGATTACACTCGAGTGTAATCGAAGGCCTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004419
VALIDATED
DUSP5 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004419.x-620s1c1
Sequence:CCGGCTGAGTGTTGCGTGGATGTAACTCGAGTTACATCCACGCAACACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004419.x-2213s1c1
Sequence:CCGGCCTGTCCTTCTGTGTGCTTATCTCGAGATAAGCACACAGAAGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004419.x-1014s1c1
Sequence:CCGGCCGTTCACCCACCATCTGCATCTCGAGATGCAGATGGTGGGTGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004419.x-1224s1c1
Sequence:CCGGGATAGGCCATTTGCAGACACTCTCGAGAGTGTCTGCAAATGGCCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004419.x-869s1c1
Sequence:CCGGTGACCCACCTACACTACAAATCTCGAGATTTGTAGTGTAGGTGGGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004419.3-1391s21c1
Sequence:CCGGCAACGGCCACATCCTGCTAAACTCGAGTTTAGCAGGATGTGGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-1180s21c1
Sequence:CCGGCAGCTCCTGCAGTACGAATCTCTCGAGAGATTCGTACTGCAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-1147s21c1
Sequence:CCGGAGCATGGTCTCGCCCAACTTTCTCGAGAAAGTTGGGCGAGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-915s21c1
Sequence:CCGGGACCCACCTACACTACAAATGCTCGAGCATTTGTAGTGTAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004419.3-643s21c1
Sequence:CCGGGAGACTTTCTACTCGGAATATCTCGAGATATTCCGAGTAGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004419.3-666s21c1
Sequence:CCGGTGAGTGTTGCGTGGATGTAAACTCGAGTTTACATCCACGCAACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_004419.3-1112s21c1
Sequence:CCGGTGAAGGAGGCCTTCGATTACACTCGAGTGTAATCGAAGGCCTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_140740
DUSP5 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_140740.5-2094s1c1
Sequence:CCGGCCTTGGACTTTGGTGTGATTTCTCGAGAAATCACACCAAAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-1294s1c1
Sequence:CCGGTCCACGTTTATAGGCCATTTACTCGAGTAAATGGCCTATAAACGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-822s1c1
Sequence:CCGGCCCGGTTGAAATCCTTCCCTTCTCGAGAAGGGAAGGATTTCAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-994s1c1
Sequence:CCGGGCTGACATTAGCTCCCACTTTCTCGAGAAAGTGGGAGCTAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-676s1c1
Sequence:CCGGGAGACCTTCTACTCACAGTATCTCGAGATACTGTGAGTAGAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_140740
DUSP5 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_140740.5-2094s1c1
Sequence:CCGGCCTTGGACTTTGGTGTGATTTCTCGAGAAATCACACCAAAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-1294s1c1
Sequence:CCGGTCCACGTTTATAGGCCATTTACTCGAGTAAATGGCCTATAAACGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-822s1c1
Sequence:CCGGCCCGGTTGAAATCCTTCCCTTCTCGAGAAGGGAAGGATTTCAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-994s1c1
Sequence:CCGGGCTGACATTAGCTCCCACTTTCTCGAGAAAGTGGGAGCTAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-676s1c1
Sequence:CCGGGAGACCTTCTACTCACAGTATCTCGAGATACTGTGAGTAGAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_140740
DUSP5 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_140740.5-2094s1c1
Sequence:CCGGCCTTGGACTTTGGTGTGATTTCTCGAGAAATCACACCAAAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-1294s1c1
Sequence:CCGGTCCACGTTTATAGGCCATTTACTCGAGTAAATGGCCTATAAACGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-822s1c1
Sequence:CCGGCCCGGTTGAAATCCTTCCCTTCTCGAGAAGGGAAGGATTTCAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-994s1c1
Sequence:CCGGGCTGACATTAGCTCCCACTTTCTCGAGAAAGTGGGAGCTAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140740.5-676s1c1
Sequence:CCGGGAGACCTTCTACTCACAGTATCTCGAGATACTGTGAGTAGAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks