EMAIL THIS PAGE TO A FRIEND

DUSP6

dual specificity phosphatase 6

188 Gene Product Result for
Synonyms: HH19 MKP3 PYST1
UniProtKB ID: Q16828, O75109, Q53Y75, Q9BSH6
Gene ID:
Human(1848) Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67603) dual specificity phosphatase 6
Rat(116663) dual specificity phosphatase 6
Zebrafish(353314) dual specificity phosphatase 6
cow(515310) dual specificity phosphatase 6
Horse(100051565) dual specificity phosphatase 6
domestic cat(101097255) dual specificity phosphatase 6
dog(482594) dual specificity phosphatase 6
chicken(374272) dual specificity phosphatase 6
naked mole-rat(101697963) dual specificity phosphatase 6
domestic guinea pig(100720904) dual specificity phosphatase 6
sheep(101110315) dual specificity phosphatase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001946 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001946 Rosetta Predictions human pricing
NM_022652 Rosetta Predictions human pricing
NM_053883 Rosetta Predictions rat pricing
NM_026268 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075773 predicted 1780
2 SASI_Hs01_00075774 predicted 1521
3 SASI_Hs01_00075775 predicted 1762
4 SASI_Hs01_00075777 predicted 512
5 SASI_Hs01_00075778 predicted 1602
6 SASI_Hs02_00332861 predicted 1799
7 SASI_Hs01_00075779 predicted 1679
8 SASI_Hs01_00075780 predicted 1607
9 SASI_Hs01_00075781 predicted 1574
10 SASI_Hs02_00332862 predicted 1516
11 SASI_Hs01_00075772 predicted 1790
12 SASI_Hs01_00247564 predicted 1169
13 SASI_Hs01_00247565 predicted 992
14 SASI_Hs01_00247566 predicted 1054
15 SASI_Hs01_00247567 predicted 1000
16 SASI_Hs01_00247568 predicted 1227
17 SASI_Hs01_00075776 predicted 1842
18 SASI_Hs01_00247569 predicted 1146
19 SASI_Hs01_00247570 predicted 1168
20 SASI_Hs01_00247571 predicted 1142
21 SASI_Hs01_00247572 predicted 1215
22 SASI_Hs01_00247573 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194964 predicted 1345
2 SASI_Hs01_00194965 predicted 1086
3 SASI_Hs01_00194966 predicted 1321
4 SASI_Hs01_00194968 predicted 513
5 SASI_Hs01_00194969 predicted 1161
6 SASI_Hs02_00355915 predicted 1363
7 SASI_Hs01_00194970 predicted 1243
8 SASI_Hs01_00194971 predicted 1168
9 SASI_Hs01_00194972 predicted 1135
10 SASI_Hs02_00355916 predicted 1080
11 SASI_Hs01_00194963 predicted 1353
12 SASI_Hs01_00194967 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074707 predicted 816
2 SASI_Rn01_00074708 predicted 1122
3 SASI_Rn01_00074710 predicted 1158
4 SASI_Rn02_00266790 predicted 1198
5 SASI_Rn01_00074711 predicted 1371
6 SASI_Rn01_00074712 predicted 1154
7 SASI_Rn01_00074713 predicted 1093
8 SASI_Rn01_00074714 predicted 1193
9 SASI_Rn01_00074715 predicted 728
10 SASI_Rn01_00074716 predicted 611
11 SASI_Rn01_00074709 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051559 predicted 1818
2 SASI_Mm01_00051560 predicted 1150
3 SASI_Mm01_00051561 predicted 1764
4 SASI_Mm01_00051562 predicted 1416
5 SASI_Mm01_00051563 predicted 1181
6 SASI_Mm01_00051564 predicted 1343
7 SASI_Mm01_00051565 predicted 603
8 SASI_Mm01_00051566 predicted 1119
9 SASI_Mm02_00329957 predicted 1144
10 SASI_Mm02_00329958 predicted 1222
11 SASI_Mm01_00051567 predicted 1840
12 SASI_Mm01_00051568 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001946
VALIDATED
DUSP6 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 6
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-915s21c1
Sequence:CCGGGCATTGCGAGACCAATCTAGACTCGAGTCTAGATTGGTCTCGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001946.2-1985s21c1
Sequence:CCGGGCATCTGGAACTGACTATATACTCGAGTATATAGTCAGTTCCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1578s21c1
Sequence:CCGGCCCTTCCAACCAGAATGTATACTCGAGTATACATTCTGGTTGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1170s21c1
Sequence:CCGGATTCGGCATCAAGTACATCTTCTCGAGAAGATGTACTTGATGCCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001946.2-2101s21c1
Sequence:CCGGCTGATACTCCATTTGATTATTCTCGAGAATAATCAAATGGAGTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-2275s21c1
Sequence:CCGGTCTAATCCAAAGGGTATATTTCTCGAGAAATATACCCTTTGGATTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-1427s21c1
Sequence:CCGGTGAACGATGCCTATGACATTGCTCGAGCAATGTCATAGGCATCGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-1338s21c1
Sequence:CCGGCTGTGGTGTCTTGGTACATTGCTCGAGCAATGTACCAAGACACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-1222s21c1
Sequence:CCGGGAGAACGCAGGAGAGTTTAAACTCGAGTTTAAACTCTCCTGCGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-785s21c1
Sequence:CCGGGCAGCGACTGGAACGAGAATACTCGAGTATTCTCGTTCCAGTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1609s21c1
Sequence:CCGGTCTCTGCAATCTACGTGAAAGCTCGAGCTTTCACGTAGATTGCAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1400s21c1
Sequence:CCGGACCTTATGCAGAAGCTCAATCCTCGAGGATTGAGCTTCTGCATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1551s21c1
Sequence:CCGGTCCAGCACAGCAGCTGTATTTCTCGAGAAATACAGCTGCTGTGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-920s1c1
Sequence:CCGGGTGCAACAGACTCGGATGGTACTCGAGTACCATCCGAGTCTGTTGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-759s1c1
Sequence:CCGGCAGTAAGTTCCAAGCCGAGTTCTCGAGAACTCGGCTTGGAACTTACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-761s1c1
Sequence:CCGGGTAAGTTCCAAGCCGAGTTCTCTCGAGAGAACTCGGCTTGGAACTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001946.x-1023s1c1
Sequence:CCGGCTTGGACGTGTTGGAGGAATTCTCGAGAATTCCTCCAACACGTCCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-1022s1c1
Sequence:CCGGACTTGGACGTGTTGGAGGAATCTCGAGATTCCTCCAACACGTCCAAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001946
VALIDATED
DUSP6 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 6
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-915s21c1
Sequence:CCGGGCATTGCGAGACCAATCTAGACTCGAGTCTAGATTGGTCTCGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001946.2-1985s21c1
Sequence:CCGGGCATCTGGAACTGACTATATACTCGAGTATATAGTCAGTTCCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1578s21c1
Sequence:CCGGCCCTTCCAACCAGAATGTATACTCGAGTATACATTCTGGTTGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1170s21c1
Sequence:CCGGATTCGGCATCAAGTACATCTTCTCGAGAAGATGTACTTGATGCCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001946.2-2101s21c1
Sequence:CCGGCTGATACTCCATTTGATTATTCTCGAGAATAATCAAATGGAGTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-2275s21c1
Sequence:CCGGTCTAATCCAAAGGGTATATTTCTCGAGAAATATACCCTTTGGATTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-1427s21c1
Sequence:CCGGTGAACGATGCCTATGACATTGCTCGAGCAATGTCATAGGCATCGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-1338s21c1
Sequence:CCGGCTGTGGTGTCTTGGTACATTGCTCGAGCAATGTACCAAGACACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-1222s21c1
Sequence:CCGGGAGAACGCAGGAGAGTTTAAACTCGAGTTTAAACTCTCCTGCGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-785s21c1
Sequence:CCGGGCAGCGACTGGAACGAGAATACTCGAGTATTCTCGTTCCAGTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1609s21c1
Sequence:CCGGTCTCTGCAATCTACGTGAAAGCTCGAGCTTTCACGTAGATTGCAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1400s21c1
Sequence:CCGGACCTTATGCAGAAGCTCAATCCTCGAGGATTGAGCTTCTGCATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1551s21c1
Sequence:CCGGTCCAGCACAGCAGCTGTATTTCTCGAGAAATACAGCTGCTGTGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-920s1c1
Sequence:CCGGGTGCAACAGACTCGGATGGTACTCGAGTACCATCCGAGTCTGTTGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-759s1c1
Sequence:CCGGCAGTAAGTTCCAAGCCGAGTTCTCGAGAACTCGGCTTGGAACTTACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-761s1c1
Sequence:CCGGGTAAGTTCCAAGCCGAGTTCTCTCGAGAGAACTCGGCTTGGAACTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001946.x-1023s1c1
Sequence:CCGGCTTGGACGTGTTGGAGGAATTCTCGAGAATTCCTCCAACACGTCCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-1022s1c1
Sequence:CCGGACTTGGACGTGTTGGAGGAATCTCGAGATTCCTCCAACACGTCCAAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001946
VALIDATED
DUSP6 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 6
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-915s21c1
Sequence:CCGGGCATTGCGAGACCAATCTAGACTCGAGTCTAGATTGGTCTCGCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001946.2-1985s21c1
Sequence:CCGGGCATCTGGAACTGACTATATACTCGAGTATATAGTCAGTTCCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1578s21c1
Sequence:CCGGCCCTTCCAACCAGAATGTATACTCGAGTATACATTCTGGTTGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1170s21c1
Sequence:CCGGATTCGGCATCAAGTACATCTTCTCGAGAAGATGTACTTGATGCCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001946.2-2101s21c1
Sequence:CCGGCTGATACTCCATTTGATTATTCTCGAGAATAATCAAATGGAGTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-2275s21c1
Sequence:CCGGTCTAATCCAAAGGGTATATTTCTCGAGAAATATACCCTTTGGATTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-1427s21c1
Sequence:CCGGTGAACGATGCCTATGACATTGCTCGAGCAATGTCATAGGCATCGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-1338s21c1
Sequence:CCGGCTGTGGTGTCTTGGTACATTGCTCGAGCAATGTACCAAGACACCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001946.2-1222s21c1
Sequence:CCGGGAGAACGCAGGAGAGTTTAAACTCGAGTTTAAACTCTCCTGCGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-785s21c1
Sequence:CCGGGCAGCGACTGGAACGAGAATACTCGAGTATTCTCGTTCCAGTCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1609s21c1
Sequence:CCGGTCTCTGCAATCTACGTGAAAGCTCGAGCTTTCACGTAGATTGCAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1400s21c1
Sequence:CCGGACCTTATGCAGAAGCTCAATCCTCGAGGATTGAGCTTCTGCATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001946.2-1551s21c1
Sequence:CCGGTCCAGCACAGCAGCTGTATTTCTCGAGAAATACAGCTGCTGTGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-920s1c1
Sequence:CCGGGTGCAACAGACTCGGATGGTACTCGAGTACCATCCGAGTCTGTTGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-759s1c1
Sequence:CCGGCAGTAAGTTCCAAGCCGAGTTCTCGAGAACTCGGCTTGGAACTTACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-761s1c1
Sequence:CCGGGTAAGTTCCAAGCCGAGTTCTCTCGAGAGAACTCGGCTTGGAACTTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001946.x-1023s1c1
Sequence:CCGGCTTGGACGTGTTGGAGGAATTCTCGAGAATTCCTCCAACACGTCCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001946.x-1022s1c1
Sequence:CCGGACTTGGACGTGTTGGAGGAATCTCGAGATTCCTCCAACACGTCCAAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026268
VALIDATED
DUSP6 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026268.2-1151s21c1
Sequence:CCGGGTTTGGCATCAAGTACATCTTCTCGAGAAGATGTACTTGATGCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.2-606s21c1
Sequence:CCGGCACATCGAATCTGCCATTAATCTCGAGATTAATGGCAGATTCGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.2-745s21c1
Sequence:CCGGTGGTGCTGTACGACGAGAATACTCGAGTATTCTCGTCGTACAGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.2-1590s21c1
Sequence:CCGGTCCCTGCAGTCTACGTGAAAGCTCGAGCTTTCACGTAGACTGCAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026268.3-1214s21c1
Sequence:CCGGCGAGTTCAAATACAAGCAAATCTCGAGATTTGCTTGTATTTGAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.3-1183s21c1
Sequence:CCGGCCAATTTGCCCAATCTGTTTGCTCGAGCAAACAGATTGGGCAAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026268.2-1959s21c1
Sequence:CCGGTTGCATCTGGAACTAACTATACTCGAGTATAGTTAGTTCCAGATGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-1413s1c1
Sequence:CCGGCGATGCTTACGACATTGTTAACTCGAGTTAACAATGTCGTAAGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-1401s1c1
Sequence:CCGGCCTGTCCATGAACGATGCTTACTCGAGTAAGCATCGTTCATGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026268.1-1279s1c1
Sequence:CCGGCCTGAGGCCATTTCTTTCATACTCGAGTATGAAAGAAATGGCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-605s1c1
Sequence:CCGGCACACATCGAATCTGCCATTACTCGAGTAATGGCAGATTCGATGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-1152s1c1
Sequence:CCGGGTTTGGCATCAAGTACATCTTCTCGAGAAGATGTACTTGATGCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026268
VALIDATED
DUSP6 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026268.2-1151s21c1
Sequence:CCGGGTTTGGCATCAAGTACATCTTCTCGAGAAGATGTACTTGATGCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.2-606s21c1
Sequence:CCGGCACATCGAATCTGCCATTAATCTCGAGATTAATGGCAGATTCGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.2-745s21c1
Sequence:CCGGTGGTGCTGTACGACGAGAATACTCGAGTATTCTCGTCGTACAGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.2-1590s21c1
Sequence:CCGGTCCCTGCAGTCTACGTGAAAGCTCGAGCTTTCACGTAGACTGCAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026268.3-1214s21c1
Sequence:CCGGCGAGTTCAAATACAAGCAAATCTCGAGATTTGCTTGTATTTGAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.3-1183s21c1
Sequence:CCGGCCAATTTGCCCAATCTGTTTGCTCGAGCAAACAGATTGGGCAAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026268.2-1959s21c1
Sequence:CCGGTTGCATCTGGAACTAACTATACTCGAGTATAGTTAGTTCCAGATGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-1413s1c1
Sequence:CCGGCGATGCTTACGACATTGTTAACTCGAGTTAACAATGTCGTAAGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-1401s1c1
Sequence:CCGGCCTGTCCATGAACGATGCTTACTCGAGTAAGCATCGTTCATGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026268.1-1279s1c1
Sequence:CCGGCCTGAGGCCATTTCTTTCATACTCGAGTATGAAAGAAATGGCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-605s1c1
Sequence:CCGGCACACATCGAATCTGCCATTACTCGAGTAATGGCAGATTCGATGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-1152s1c1
Sequence:CCGGGTTTGGCATCAAGTACATCTTCTCGAGAAGATGTACTTGATGCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026268
VALIDATED
DUSP6 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026268.2-1151s21c1
Sequence:CCGGGTTTGGCATCAAGTACATCTTCTCGAGAAGATGTACTTGATGCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.2-606s21c1
Sequence:CCGGCACATCGAATCTGCCATTAATCTCGAGATTAATGGCAGATTCGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.2-745s21c1
Sequence:CCGGTGGTGCTGTACGACGAGAATACTCGAGTATTCTCGTCGTACAGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.2-1590s21c1
Sequence:CCGGTCCCTGCAGTCTACGTGAAAGCTCGAGCTTTCACGTAGACTGCAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026268.3-1214s21c1
Sequence:CCGGCGAGTTCAAATACAAGCAAATCTCGAGATTTGCTTGTATTTGAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026268.3-1183s21c1
Sequence:CCGGCCAATTTGCCCAATCTGTTTGCTCGAGCAAACAGATTGGGCAAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026268.2-1959s21c1
Sequence:CCGGTTGCATCTGGAACTAACTATACTCGAGTATAGTTAGTTCCAGATGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-1413s1c1
Sequence:CCGGCGATGCTTACGACATTGTTAACTCGAGTTAACAATGTCGTAAGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-1401s1c1
Sequence:CCGGCCTGTCCATGAACGATGCTTACTCGAGTAAGCATCGTTCATGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026268.1-1279s1c1
Sequence:CCGGCCTGAGGCCATTTCTTTCATACTCGAGTATGAAAGAAATGGCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-605s1c1
Sequence:CCGGCACACATCGAATCTGCCATTACTCGAGTAATGGCAGATTCGATGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026268.1-1152s1c1
Sequence:CCGGGTTTGGCATCAAGTACATCTTCTCGAGAAGATGTACTTGATGCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)