EMAIL THIS PAGE TO A FRIEND

DUSP7

dual specificity phosphatase 7

70 Gene Product Result for
Synonyms: MKPX PYST2
UniProtKB ID: Q16829, Q2M3J7, Q8NFJ0
Gene ID:
Human(1849) Summary: Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. DUSP7 belongs to a class of DUSPs, designated MKPs, that dephosphorylate MAPK (mitogen-activated protein kinase) proteins ERK (see MIM 601795), JNK (see MIM 601158), and p38 (see MIM 600289) with specificity distinct from that of individual MKP proteins. MKPs contain a highly conserved C-terminal catalytic domain and an N-terminal Cdc25 (see MIM 116947)-like (CH2) domain. MAPK activation cascades mediate various physiologic processes, including cellular proliferation, apoptosis, differentiation, and stress responses (summary by Patterson et al., 2009 [PubMed 19228121]
Mouse(235584) dual specificity phosphatase 7
Rat(300980) dual specificity phosphatase 7
sheep(101112604) dual specificity phosphatase 7
domestic guinea pig(100723574) dual specificity phosphatase 7
naked mole-rat(101699953) dual specificity phosphatase 7
Zebrafish(327246) dual specificity phosphatase 7
cow(785016) dual specificity phosphatase 7
dog(484742) dual specificity phosphatase 7
domestic cat(101101624) dual specificity phosphatase 7
chicken(415891) dual specificity phosphatase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001947 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001947 Rosetta Predictions human pricing
XM_001070874 Rosetta Predictions rat pricing
XM_238551 Rosetta Predictions rat pricing
NM_153459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241296 predicted 816
2 SASI_Hs01_00241297 predicted 903
3 SASI_Hs01_00241298 predicted 965
4 SASI_Hs01_00241299 predicted 710
5 SASI_Hs02_00332863 predicted 707
6 SASI_Hs02_00332864 predicted 464
7 SASI_Hs01_00241301 predicted 767
8 SASI_Hs01_00241302 predicted 702
9 SASI_Hs01_00241303 predicted 411
10 SASI_Hs02_00332865 predicted 696
11 SASI_Hs01_00241300 predicted 923
12 SASI_Hs01_00241304 predicted 414
13 SASI_Hs01_00241305 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333155 predicted 553
2 SASI_Rn02_00333156 predicted 1002
3 SASI_Rn02_00333157 predicted 913
4 SASI_Rn02_00333158 predicted 783
5 SASI_Rn02_00333159 predicted 982
6 SASI_Rn02_00333160 predicted 1163
7 SASI_Rn02_00333161 predicted 1023
8 SASI_Rn02_00333162 predicted 1035
9 SASI_Rn02_00333163 predicted 519
10 SASI_Rn02_00333164 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391416 predicted 1078
2 SASI_Rn02_00391417 predicted 1021
3 SASI_Rn02_00391418 predicted 975
4 SASI_Rn02_00391419 predicted 1029
5 SASI_Rn02_00391420 predicted 1175
6 SASI_Rn02_00391421 predicted 1197
7 SASI_Rn02_00391422 predicted 1060
8 SASI_Rn02_00391423 predicted 1239
9 SASI_Rn02_00391424 predicted 982
10 SASI_Rn02_00391425 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093642 predicted 1075
2 SASI_Mm01_00093643 predicted 1035
3 SASI_Mm01_00093644 predicted 1325
4 SASI_Mm01_00093645 predicted 1190
5 SASI_Mm01_00093646 predicted 1178
6 SASI_Mm01_00093647 predicted 713
7 SASI_Mm01_00093648 predicted 807
8 SASI_Mm01_00093650 predicted 1200
9 SASI_Mm01_00093651 predicted 683
10 SASI_Mm02_00343231 predicted 1229
11 SASI_Mm01_00093649 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001947
VALIDATED
DUSP7 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-645s1c1
Sequence:CCGGCGGCAAGTATGGCATCAAGTACTCGAGTACTTGATGCCATACTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-360s1c1
Sequence:CCGGCCAAGGTGGTTTCAACAAGTTCTCGAGAACTTGTTGAAACCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-917s1c1
Sequence:CCGGCCTACGACTTTGTCAAGAGGACTCGAGTCCTCTTGACAAAGTCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001947.1-714s1c1
Sequence:CCGGCGAGTTCACCTACAAGCAGATCTCGAGATCTGCTTGTAGGTGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-900s1c1
Sequence:CCGGCCTGTCACTCAACGACGCCTACTCGAGTAGGCGTCGTTGAGTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-927s21c1
Sequence:CCGGGGTCACTGTGGCCTATCTGATCTCGAGATCAGATAGGCCACAGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-968s21c1
Sequence:CCGGTCAACGACGCCTACGACTTTGCTCGAGCAAAGTCGTAGGCGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-708s21c1
Sequence:CCGGCAAGTATGGCATCAAGTATATCTCGAGATATACTTGATGCCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-845s21c1
Sequence:CCGGCCATCAGCTTCATTGACGAAGCTCGAGCTTCGTCAATGAAGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-426s21c1
Sequence:CCGGTGGTTTCAACAAGTTTCAAACCTCGAGGTTTGAAACTTGTTGAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001947
VALIDATED
DUSP7 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-645s1c1
Sequence:CCGGCGGCAAGTATGGCATCAAGTACTCGAGTACTTGATGCCATACTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-360s1c1
Sequence:CCGGCCAAGGTGGTTTCAACAAGTTCTCGAGAACTTGTTGAAACCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-917s1c1
Sequence:CCGGCCTACGACTTTGTCAAGAGGACTCGAGTCCTCTTGACAAAGTCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001947.1-714s1c1
Sequence:CCGGCGAGTTCACCTACAAGCAGATCTCGAGATCTGCTTGTAGGTGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-900s1c1
Sequence:CCGGCCTGTCACTCAACGACGCCTACTCGAGTAGGCGTCGTTGAGTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-927s21c1
Sequence:CCGGGGTCACTGTGGCCTATCTGATCTCGAGATCAGATAGGCCACAGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-968s21c1
Sequence:CCGGTCAACGACGCCTACGACTTTGCTCGAGCAAAGTCGTAGGCGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-708s21c1
Sequence:CCGGCAAGTATGGCATCAAGTATATCTCGAGATATACTTGATGCCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-845s21c1
Sequence:CCGGCCATCAGCTTCATTGACGAAGCTCGAGCTTCGTCAATGAAGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-426s21c1
Sequence:CCGGTGGTTTCAACAAGTTTCAAACCTCGAGGTTTGAAACTTGTTGAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001947
VALIDATED
DUSP7 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-645s1c1
Sequence:CCGGCGGCAAGTATGGCATCAAGTACTCGAGTACTTGATGCCATACTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-360s1c1
Sequence:CCGGCCAAGGTGGTTTCAACAAGTTCTCGAGAACTTGTTGAAACCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-917s1c1
Sequence:CCGGCCTACGACTTTGTCAAGAGGACTCGAGTCCTCTTGACAAAGTCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001947.1-714s1c1
Sequence:CCGGCGAGTTCACCTACAAGCAGATCTCGAGATCTGCTTGTAGGTGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001947.1-900s1c1
Sequence:CCGGCCTGTCACTCAACGACGCCTACTCGAGTAGGCGTCGTTGAGTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-927s21c1
Sequence:CCGGGGTCACTGTGGCCTATCTGATCTCGAGATCAGATAGGCCACAGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-968s21c1
Sequence:CCGGTCAACGACGCCTACGACTTTGCTCGAGCAAAGTCGTAGGCGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-708s21c1
Sequence:CCGGCAAGTATGGCATCAAGTATATCTCGAGATATACTTGATGCCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-845s21c1
Sequence:CCGGCCATCAGCTTCATTGACGAAGCTCGAGCTTCGTCAATGAAGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001947.2-426s21c1
Sequence:CCGGTGGTTTCAACAAGTTTCAAACCTCGAGGTTTGAAACTTGTTGAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153459
VALIDATED
DUSP7 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-1821s1c1
Sequence:CCGGCCCTGGTTCTACCATTTCCTACTCGAGTAGGAAATGGTAGAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-353s1c1
Sequence:CCGGCAGACGGAATACTCTGAGCATCTCGAGATGCTCAGAGTATTCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153459.1-872s1c1
Sequence:CCGGCTGTCCCTCAATGATGCCTATCTCGAGATAGGCATCATTGAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-604s1c1
Sequence:CCGGCCTGGATGTACTTGGCAAATACTCGAGTATTTGCCAAGTACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-1039s1c1
Sequence:CCGGCCATAACCTGTTCCCGATCAACTCGAGTTGATCGGGAACAGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153459
VALIDATED
DUSP7 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-1821s1c1
Sequence:CCGGCCCTGGTTCTACCATTTCCTACTCGAGTAGGAAATGGTAGAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-353s1c1
Sequence:CCGGCAGACGGAATACTCTGAGCATCTCGAGATGCTCAGAGTATTCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153459.1-872s1c1
Sequence:CCGGCTGTCCCTCAATGATGCCTATCTCGAGATAGGCATCATTGAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-604s1c1
Sequence:CCGGCCTGGATGTACTTGGCAAATACTCGAGTATTTGCCAAGTACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-1039s1c1
Sequence:CCGGCCATAACCTGTTCCCGATCAACTCGAGTTGATCGGGAACAGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153459
VALIDATED
DUSP7 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-1821s1c1
Sequence:CCGGCCCTGGTTCTACCATTTCCTACTCGAGTAGGAAATGGTAGAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-353s1c1
Sequence:CCGGCAGACGGAATACTCTGAGCATCTCGAGATGCTCAGAGTATTCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153459.1-872s1c1
Sequence:CCGGCTGTCCCTCAATGATGCCTATCTCGAGATAGGCATCATTGAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-604s1c1
Sequence:CCGGCCTGGATGTACTTGGCAAATACTCGAGTATTTGCCAAGTACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153459.1-1039s1c1
Sequence:CCGGCCATAACCTGTTCCCGATCAACTCGAGTTGATCGGGAACAGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks