EMAIL THIS PAGE TO A FRIEND

DUSP8

dual specificity phosphatase 8

87 Gene Product Result for
Synonyms: C11orf81 HB5 HVH-5 HVH8
UniProtKB ID: Q13202, Q86SS8
Gene ID:
Human(1850) Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates SAPK/JNK and p38, is expressed predominantly in the adult brain, heart, and skeletal muscle, is localized in the cytoplasm, and is induced by nerve growth factor and insulin. An intronless pseudogene for DUSP8 is present on chromosome 10q11.2. [provided by RefSeq, Jul 2008]
Mouse(18218) dual specificity phosphatase 8
Rat(361679) dual specificity phosphatase 8
chicken(770435) dual specificity phosphatase 8
dog(483660) dual specificity phosphatase 8
naked mole-rat(101716391) dual specificity phosphatase 8
domestic guinea pig(100731539) dual specificity phosphatase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004420 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004420 Rosetta Predictions human pricing
NM_001108510 Rosetta Predictions rat pricing
NM_008748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337572 predicted 222
2 SASI_Hs01_00148797 predicted 309
3 SASI_Hs01_00148798 predicted 634
4 SASI_Hs01_00148804 predicted 866
5 SASI_Hs02_00337573 predicted 463
6 SASI_Hs02_00337574 predicted 394
7 SASI_Hs01_00148795 predicted 807
8 SASI_Hs02_00337575 predicted 420
9 SASI_Hs02_00337576 predicted 627
10 SASI_Hs01_00148800 predicted 371
11 SASI_Hs01_00148796 predicted 953
12 SASI_Hs01_00148799 predicted 847
13 SASI_Hs01_00148801 predicted 824
14 SASI_Hs01_00148802 predicted 661
15 SASI_Hs01_00148803 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239359 predicted 677
2 SASI_Rn02_00239360 predicted 257
3 SASI_Rn02_00239361 predicted 1031
4 SASI_Rn02_00239362 predicted 830
5 SASI_Rn02_00239363 predicted 961
6 SASI_Rn02_00239364 predicted 457
7 SASI_Rn02_00239365 predicted 355
8 SASI_Rn02_00239366 predicted 634
9 SASI_Rn02_00239367 predicted 894
10 SASI_Rn02_00239368 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103042 predicted 775
2 SASI_Mm01_00103043 predicted 959
3 SASI_Mm01_00103044 predicted 776
4 SASI_Mm01_00103045 predicted 234
5 SASI_Mm01_00103046 predicted 855
6 SASI_Mm01_00103047 predicted 643
7 SASI_Mm01_00103048 predicted 848
8 SASI_Mm02_00314621 predicted 331
9 SASI_Mm02_00314622 predicted 559
10 SASI_Mm01_00103050 predicted 902
11 SASI_Mm01_00103049 predicted 609
12 SASI_Mm01_00103051 predicted 815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004420
VALIDATED
DUSP8 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 8
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2146s21c1
Sequence:CCGGTGTTCATTCTGGCAATGATTTCTCGAGAAATCATTGCCAGAATGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-314s21c1
Sequence:CCGGCAAGGTGACCATTGCGGAGCTCTCGAGAGCTCCGCAATGGTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-733s21c1
Sequence:CCGGTCATCTGCGAGAGCCGCTTCACTCGAGTGAAGCGGCTCTCGCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2036s21c1
Sequence:CCGGGCAGCCAGGCCCGTTATAAATCTCGAGATTTATAACGGGCCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2205s21c1
Sequence:CCGGGTCTGGTATTTAAACTGAAACCTCGAGGTTTCAGTTTAAATACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-683s21c1
Sequence:CCGGTGGAATAAGCTACGTCCTCAACTCGAGTTGAGGACGTAGCTTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-3678s21c1
Sequence:CCGGATCTATGGATTAGAGGTTTAACTCGAGTTAAACCTCTAATCCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-801s21c1
Sequence:CCGGCTGGACAAGTCCATCGAGTTCCTCGAGGAACTCGATGGACTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-641s21c1
Sequence:CCGGCTCGCAGAAGGACGTCCTAAACTCGAGTTTAGGACGTCCTTCTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-226s21c1
Sequence:CCGGGCTCCTTCGTGGAGTACAACACTCGAGTGTTGTACTCCACGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2069s21c1
Sequence:CCGGTAATGCAAAGAAAGGTAAATGCTCGAGCATTTACCTTTCTTTGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2307s21c1
Sequence:CCGGAGGAAACACTGCTGACCTTTGCTCGAGCAAAGGTCAGCAGTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004420.1-2150s1c1
Sequence:CCGGGCTGTTCATTCTGGCAATGATCTCGAGATCATTGCCAGAATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004420.1-908s1c1
Sequence:CCGGCGCCTACATCATGAAGACCATCTCGAGATGGTCTTCATGATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004420.1-1286s1c1
Sequence:CCGGGCAGGACACTAACCGCCTCAACTCGAGTTGAGGCGGTTAGTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004420.1-772s1c1
Sequence:CCGGTCAACGACAACTACTGTGAAACTCGAGTTTCACAGTAGTTGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004420.1-230s1c1
Sequence:CCGGCCGCTCCTTCGTGGAGTACAACTCGAGTTGTACTCCACGAAGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004420
VALIDATED
DUSP8 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 8
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2146s21c1
Sequence:CCGGTGTTCATTCTGGCAATGATTTCTCGAGAAATCATTGCCAGAATGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-314s21c1
Sequence:CCGGCAAGGTGACCATTGCGGAGCTCTCGAGAGCTCCGCAATGGTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-733s21c1
Sequence:CCGGTCATCTGCGAGAGCCGCTTCACTCGAGTGAAGCGGCTCTCGCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2036s21c1
Sequence:CCGGGCAGCCAGGCCCGTTATAAATCTCGAGATTTATAACGGGCCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2205s21c1
Sequence:CCGGGTCTGGTATTTAAACTGAAACCTCGAGGTTTCAGTTTAAATACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-683s21c1
Sequence:CCGGTGGAATAAGCTACGTCCTCAACTCGAGTTGAGGACGTAGCTTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-3678s21c1
Sequence:CCGGATCTATGGATTAGAGGTTTAACTCGAGTTAAACCTCTAATCCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-801s21c1
Sequence:CCGGCTGGACAAGTCCATCGAGTTCCTCGAGGAACTCGATGGACTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-641s21c1
Sequence:CCGGCTCGCAGAAGGACGTCCTAAACTCGAGTTTAGGACGTCCTTCTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-226s21c1
Sequence:CCGGGCTCCTTCGTGGAGTACAACACTCGAGTGTTGTACTCCACGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2069s21c1
Sequence:CCGGTAATGCAAAGAAAGGTAAATGCTCGAGCATTTACCTTTCTTTGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2307s21c1
Sequence:CCGGAGGAAACACTGCTGACCTTTGCTCGAGCAAAGGTCAGCAGTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004420.1-2150s1c1
Sequence:CCGGGCTGTTCATTCTGGCAATGATCTCGAGATCATTGCCAGAATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004420.1-908s1c1
Sequence:CCGGCGCCTACATCATGAAGACCATCTCGAGATGGTCTTCATGATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004420.1-1286s1c1
Sequence:CCGGGCAGGACACTAACCGCCTCAACTCGAGTTGAGGCGGTTAGTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004420.1-772s1c1
Sequence:CCGGTCAACGACAACTACTGTGAAACTCGAGTTTCACAGTAGTTGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004420.1-230s1c1
Sequence:CCGGCCGCTCCTTCGTGGAGTACAACTCGAGTTGTACTCCACGAAGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004420
VALIDATED
DUSP8 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 8
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2146s21c1
Sequence:CCGGTGTTCATTCTGGCAATGATTTCTCGAGAAATCATTGCCAGAATGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-314s21c1
Sequence:CCGGCAAGGTGACCATTGCGGAGCTCTCGAGAGCTCCGCAATGGTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-733s21c1
Sequence:CCGGTCATCTGCGAGAGCCGCTTCACTCGAGTGAAGCGGCTCTCGCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2036s21c1
Sequence:CCGGGCAGCCAGGCCCGTTATAAATCTCGAGATTTATAACGGGCCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2205s21c1
Sequence:CCGGGTCTGGTATTTAAACTGAAACCTCGAGGTTTCAGTTTAAATACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-683s21c1
Sequence:CCGGTGGAATAAGCTACGTCCTCAACTCGAGTTGAGGACGTAGCTTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-3678s21c1
Sequence:CCGGATCTATGGATTAGAGGTTTAACTCGAGTTAAACCTCTAATCCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-801s21c1
Sequence:CCGGCTGGACAAGTCCATCGAGTTCCTCGAGGAACTCGATGGACTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-641s21c1
Sequence:CCGGCTCGCAGAAGGACGTCCTAAACTCGAGTTTAGGACGTCCTTCTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004420.2-226s21c1
Sequence:CCGGGCTCCTTCGTGGAGTACAACACTCGAGTGTTGTACTCCACGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2069s21c1
Sequence:CCGGTAATGCAAAGAAAGGTAAATGCTCGAGCATTTACCTTTCTTTGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004420.2-2307s21c1
Sequence:CCGGAGGAAACACTGCTGACCTTTGCTCGAGCAAAGGTCAGCAGTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004420.1-2150s1c1
Sequence:CCGGGCTGTTCATTCTGGCAATGATCTCGAGATCATTGCCAGAATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004420.1-908s1c1
Sequence:CCGGCGCCTACATCATGAAGACCATCTCGAGATGGTCTTCATGATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004420.1-1286s1c1
Sequence:CCGGGCAGGACACTAACCGCCTCAACTCGAGTTGAGGCGGTTAGTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004420.1-772s1c1
Sequence:CCGGTCAACGACAACTACTGTGAAACTCGAGTTTCACAGTAGTTGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004420.1-230s1c1
Sequence:CCGGCCGCTCCTTCGTGGAGTACAACTCGAGTTGTACTCCACGAAGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008748
VALIDATED
DUSP8 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008748.2-2115s21c1
Sequence:CCGGTCCAGCCAGGCCAGGTATAAACTCGAGTTTATACCTGGCCTGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008748.2-806s21c1
Sequence:CCGGTGTCCAGCTGCCAAGTCATTGCTCGAGCAATGACTTGGCAGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008748.2-285s21c1
Sequence:CCGGAGTGACAATTGCTGAGCTTATCTCGAGATAAGCTCAGCAATTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008748.2-192s21c1
Sequence:CCGGCCGGTCCTTCGTGGAGTATAACTCGAGTTATACTCCACGAAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008748.2-2064s21c1
Sequence:CCGGCGTGGAGGTCATCGAAGTATCCTCGAGGATACTTCGATGACCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008748.1-907s1c1
Sequence:CCGGCGACGCATACAGGTTTGTGAACTCGAGTTCACAAACCTGTATGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008748.1-231s1c1
Sequence:CCGGGCTCTGTGAATATCTGCTGTTCTCGAGAACAGCAGATATTCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008748.1-1288s1c1
Sequence:CCGGCCTGGACATCAAGTCGGCCTACTCGAGTAGGCCGACTTGATGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008748.1-866s1c1
Sequence:CCGGGCCATCGCGTACATCATGAAACTCGAGTTTCATGATGTACGCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008748.1-784s1c1
Sequence:CCGGCGAGTTTATTGATAAAGCCAACTCGAGTTGGCTTTATCAATAAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008748
VALIDATED
DUSP8 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008748.2-2115s21c1
Sequence:CCGGTCCAGCCAGGCCAGGTATAAACTCGAGTTTATACCTGGCCTGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008748.2-806s21c1
Sequence:CCGGTGTCCAGCTGCCAAGTCATTGCTCGAGCAATGACTTGGCAGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008748.2-285s21c1
Sequence:CCGGAGTGACAATTGCTGAGCTTATCTCGAGATAAGCTCAGCAATTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008748.2-192s21c1
Sequence:CCGGCCGGTCCTTCGTGGAGTATAACTCGAGTTATACTCCACGAAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008748.2-2064s21c1
Sequence:CCGGCGTGGAGGTCATCGAAGTATCCTCGAGGATACTTCGATGACCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008748.1-907s1c1
Sequence:CCGGCGACGCATACAGGTTTGTGAACTCGAGTTCACAAACCTGTATGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008748.1-231s1c1
Sequence:CCGGGCTCTGTGAATATCTGCTGTTCTCGAGAACAGCAGATATTCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008748.1-1288s1c1
Sequence:CCGGCCTGGACATCAAGTCGGCCTACTCGAGTAGGCCGACTTGATGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008748.1-866s1c1
Sequence:CCGGGCCATCGCGTACATCATGAAACTCGAGTTTCATGATGTACGCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008748.1-784s1c1
Sequence:CCGGCGAGTTTATTGATAAAGCCAACTCGAGTTGGCTTTATCAATAAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008748
VALIDATED
DUSP8 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008748.2-2115s21c1
Sequence:CCGGTCCAGCCAGGCCAGGTATAAACTCGAGTTTATACCTGGCCTGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008748.2-806s21c1
Sequence:CCGGTGTCCAGCTGCCAAGTCATTGCTCGAGCAATGACTTGGCAGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008748.2-285s21c1
Sequence:CCGGAGTGACAATTGCTGAGCTTATCTCGAGATAAGCTCAGCAATTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008748.2-192s21c1
Sequence:CCGGCCGGTCCTTCGTGGAGTATAACTCGAGTTATACTCCACGAAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008748.2-2064s21c1
Sequence:CCGGCGTGGAGGTCATCGAAGTATCCTCGAGGATACTTCGATGACCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008748.1-907s1c1
Sequence:CCGGCGACGCATACAGGTTTGTGAACTCGAGTTCACAAACCTGTATGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008748.1-231s1c1
Sequence:CCGGGCTCTGTGAATATCTGCTGTTCTCGAGAACAGCAGATATTCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008748.1-1288s1c1
Sequence:CCGGCCTGGACATCAAGTCGGCCTACTCGAGTAGGCCGACTTGATGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008748.1-866s1c1
Sequence:CCGGGCCATCGCGTACATCATGAAACTCGAGTTTCATGATGTACGCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008748.1-784s1c1
Sequence:CCGGCGAGTTTATTGATAAAGCCAACTCGAGTTGGCTTTATCAATAAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks