EMAIL THIS PAGE TO A FRIEND

DUT

deoxyuridine triphosphatase

124 Gene Product Result for
Synonyms: dUTPase
Gene ID:
Human(1854) Summary: This gene encodes an essential enzyme of nucleotide metabolism. The encoded protein forms a ubiquitous, homotetrameric enzyme that hydrolyzes dUTP to dUMP and pyrophosphate. This reaction serves two cellular purposes: providing a precursor (dUMP) for the synthesis of thymine nucleotides needed for DNA replication, and limiting intracellular pools of dUTP. Elevated levels of dUTP lead to increased incorporation of uracil into DNA, which induces extensive excision repair mediated by uracil glycosylase. This repair process, resulting in the removal and reincorporation of dUTP, is self-defeating and leads to DNA fragmentation and cell death. Alternative splicing of this gene leads to different isoforms that localize to either the mitochondrion or nucleus. A related pseudogene is located on chromosome 19. [provided by RefSeq, Jul 2008]
Mouse(110074) deoxyuridine triphosphatase
Rat(497778) deoxyuridine triphosphatase
naked mole-rat(101718828) deoxyuridine triphosphatase
domestic guinea pig(100717103) deoxyuridine triphosphatase
sheep(101110765) deoxyuridine triphosphatase
Zebrafish(449835) dUTP pyrophosphatase
chicken(769338) deoxyuridine triphosphatase
cow(507945) deoxyuridine triphosphatase
domestic cat(101099971) deoxyuridine triphosphatase
dog(609526) deoxyuridine triphosphatase
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D5820 Anti-DUT (119-130) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
D5695 Anti-DUT (46-60) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW21425 Anti-DUT antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV46027 Anti-DUT antibody produced in rabbit IgG fraction of antiserum human, rat, rabbit, canine, horse, mouse, guinea pig
immunohistochemistry, western blot pricing
HPA060360 Anti-DUT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA054422 Anti-DUT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103922 Anti-DUT, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0001854M1 Monoclonal Anti-DUT antibody produced in mouse clone 1C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB4200044 Monoclonal Anti-dUTPase antibody produced in rat ~1.0 mg/mL, clone HUTP 3E6, purified immunoglobulin, buffered aqueous solution human, mouse, marmoset
immunocytochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025248 Rosetta Predictions human pricing
NM_001025249 Rosetta Predictions human pricing
NM_001948 Rosetta Predictions human pricing
NM_001040271 Rosetta Predictions rat pricing
NM_053592 Rosetta Predictions rat pricing
NM_023595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203260 predicted 1225
2 SASI_Hs01_00203262 predicted 1286
3 SASI_Hs01_00203264 predicted 1263
4 SASI_Hs01_00203265 predicted 123
5 SASI_Hs01_00203266 predicted 529
6 SASI_Hs01_00203267 predicted 1184
7 SASI_Hs01_00203268 predicted 648
8 SASI_Hs02_00307429 predicted 1341
9 SASI_Hs02_00307430 predicted 1216
10 SASI_Hs02_00307431 predicted 668
11 SASI_Hs01_00203259 predicted 657
12 SASI_Hs01_00203261 predicted 1229
13 SASI_Hs01_00203263 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221463 predicted 909
2 SASI_Hs01_00221465 predicted 967
3 SASI_Hs01_00221467 predicted 941
4 SASI_Hs01_00221468 predicted 215
5 SASI_Hs01_00221469 predicted 865
6 SASI_Hs01_00221470 predicted 331
7 SASI_Hs01_00221471 predicted 1019
8 SASI_Hs02_00307432 predicted 900
9 SASI_Hs02_00307433 predicted 355
10 SASI_Hs02_00307434 predicted 1010
11 SASI_Hs01_00221462 predicted 333
12 SASI_Hs01_00221464 predicted 918
13 SASI_Hs01_00221466 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218220 predicted 955
2 SASI_Hs01_00218222 predicted 1016
3 SASI_Hs01_00218224 predicted 991
4 SASI_Hs01_00218225 predicted 258
5 SASI_Hs01_00218226 predicted 909
6 SASI_Hs01_00218227 predicted 372
7 SASI_Hs01_00218228 predicted 1068
8 SASI_Hs02_00332866 predicted 941
9 SASI_Hs02_00332867 predicted 396
10 SASI_Hs02_00332868 predicted 1054
11 SASI_Hs01_00218219 predicted 383
12 SASI_Hs01_00218221 predicted 961
13 SASI_Hs01_00218223 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076822 predicted 305
2 SASI_Rn01_00076823 predicted 417
3 SASI_Rn01_00076824 predicted 437
4 SASI_Rn01_00076825 predicted 270
5 SASI_Rn01_00076826 predicted 312
6 SASI_Rn01_00076827 predicted 395
7 SASI_Rn01_00076828 predicted 342
8 SASI_Rn02_00204914 predicted 267
9 SASI_Rn01_00076830 predicted 411
10 SASI_Rn02_00204915 predicted 271
11 SASI_Rn01_00076829 predicted 287
12 SASI_Rn01_00076831 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051892 predicted 419
2 SASI_Rn01_00051893 predicted 536
3 SASI_Rn01_00051894 predicted 561
4 SASI_Rn01_00051895 predicted 390
5 SASI_Rn01_00051896 predicted 424
6 SASI_Rn01_00051897 predicted 512
7 SASI_Rn01_00051898 predicted 455
8 SASI_Rn02_00266270 predicted 384
9 SASI_Rn01_00051900 predicted 537
10 SASI_Rn01_00051901 predicted 514
11 SASI_Rn01_00051899 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090796 predicted 265
2 SASI_Mm01_00090798 predicted 394
3 SASI_Mm02_00327201 predicted 409
4 SASI_Mm01_00090799 predicted 253
5 SASI_Mm01_00090801 predicted 548
6 SASI_Mm02_00327202 predicted 259
7 SASI_Mm01_00090802 predicted 304
8 SASI_Mm01_00090803 predicted 491
9 SASI_Mm01_00090804 predicted 380
10 SASI_Mm01_00090805 predicted 259
11 SASI_Mm01_00090797 predicted 530
12 SASI_Mm01_00090800 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001948
DUT MISSION shRNA Bacterial Glycerol Stock
deoxyuridine triphosphatase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001948.3-524s21c1
Sequence:CCGGCCTTGGATGACACCGAAAGGGCTCGAGCCCTTTCGGTGTCATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001948.3-336s21c1
Sequence:CCGGACGGTCAGGCTTGGCTGCAAACTCGAGTTTGCAGCCAAGCCTGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001948.3-409s21c1
Sequence:CCGGGTTGGTGTTGTACTGTTTAATCTCGAGATTAAACAGTACAACACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001948.3-805s21c1
Sequence:CCGGTCCGCAATTGAAGGTTGTATGCTCGAGCATACAACCTTCAATTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-173s1c1
Sequence:CCGGAGTGCCTATGATTACACAATACTCGAGTATTGTGTAATCATAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-437s1c1
Sequence:CCGGCCAGAAATAGAAGAAGTTCAACTCGAGTTGAACTTCTTCTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-236s1c1
Sequence:CCGGGCGCTCCCTTCTGGGTGTTATCTCGAGATAACACCCAGAAGGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-311s1c1
Sequence:CCGGGCTGGTGTCATAGATGAAGATCTCGAGATCTTCATCTATGACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-493s1c1
Sequence:CCGGTGGTTCCACTGGAAAGAATTACTCGAGTAATTCTTTCCAGTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001948
DUT MISSION shRNA shRNA Plasmid DNA
deoxyuridine triphosphatase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001948.3-524s21c1
Sequence:CCGGCCTTGGATGACACCGAAAGGGCTCGAGCCCTTTCGGTGTCATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001948.3-336s21c1
Sequence:CCGGACGGTCAGGCTTGGCTGCAAACTCGAGTTTGCAGCCAAGCCTGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001948.3-409s21c1
Sequence:CCGGGTTGGTGTTGTACTGTTTAATCTCGAGATTAAACAGTACAACACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001948.3-805s21c1
Sequence:CCGGTCCGCAATTGAAGGTTGTATGCTCGAGCATACAACCTTCAATTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-173s1c1
Sequence:CCGGAGTGCCTATGATTACACAATACTCGAGTATTGTGTAATCATAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-437s1c1
Sequence:CCGGCCAGAAATAGAAGAAGTTCAACTCGAGTTGAACTTCTTCTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-236s1c1
Sequence:CCGGGCGCTCCCTTCTGGGTGTTATCTCGAGATAACACCCAGAAGGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-311s1c1
Sequence:CCGGGCTGGTGTCATAGATGAAGATCTCGAGATCTTCATCTATGACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-493s1c1
Sequence:CCGGTGGTTCCACTGGAAAGAATTACTCGAGTAATTCTTTCCAGTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001948
DUT MISSION shRNA Lentiviral Transduction Particles
deoxyuridine triphosphatase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001948.3-524s21c1
Sequence:CCGGCCTTGGATGACACCGAAAGGGCTCGAGCCCTTTCGGTGTCATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001948.3-336s21c1
Sequence:CCGGACGGTCAGGCTTGGCTGCAAACTCGAGTTTGCAGCCAAGCCTGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001948.3-409s21c1
Sequence:CCGGGTTGGTGTTGTACTGTTTAATCTCGAGATTAAACAGTACAACACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001948.3-805s21c1
Sequence:CCGGTCCGCAATTGAAGGTTGTATGCTCGAGCATACAACCTTCAATTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-173s1c1
Sequence:CCGGAGTGCCTATGATTACACAATACTCGAGTATTGTGTAATCATAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-437s1c1
Sequence:CCGGCCAGAAATAGAAGAAGTTCAACTCGAGTTGAACTTCTTCTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-236s1c1
Sequence:CCGGGCGCTCCCTTCTGGGTGTTATCTCGAGATAACACCCAGAAGGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-311s1c1
Sequence:CCGGGCTGGTGTCATAGATGAAGATCTCGAGATCTTCATCTATGACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001948.2-493s1c1
Sequence:CCGGTGGTTCCACTGGAAAGAATTACTCGAGTAATTCTTTCCAGTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023595
VALIDATED
DUT MISSION shRNA Bacterial Glycerol Stock
deoxyuridine triphosphatase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-417s21c1
Sequence:CCGGGCCATCGTGAAGACAGACATTCTCGAGAATGTCTGTCTTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-533s21c1
Sequence:CCGGCGAGGATTACAGAGGAAACGTCTCGAGACGTTTCCTCTGTAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-374s21c1
Sequence:CCGGCCTATTCAGTGCCTATGATTACTCGAGTAATCATAGGCACTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-479s21c1
Sequence:CCGGACGTTCTGGCTTGGCTGTAAACTCGAGTTTACAGCCAAGCCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-729s21c1
Sequence:CCGGGCTGGAAGTATCTCGCTGTTTCTCGAGAAACAGCGAGATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023595.3-593s1c1
Sequence:CCGGCGTGCTGTTTAACTTTGGGAACTCGAGTTCCCAAAGTTAAACAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-566s1c1
Sequence:CCGGCGAGGATTACAGAGGAAACGTCTCGAGACGTTTCCTCTGTAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-762s1c1
Sequence:CCGGGCTGGAAGTATCTCGCTGTTTCTCGAGAAACAGCGAGATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-666s1c1
Sequence:CCGGCGGATTTCTTATCCAGACTTACTCGAGTAAGTCTGGATAAGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-450s1c1
Sequence:CCGGGCCATCGTGAAGACAGACATTCTCGAGAATGTCTGTCTTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023595
VALIDATED
DUT MISSION shRNA shRNA Plasmid DNA
deoxyuridine triphosphatase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-417s21c1
Sequence:CCGGGCCATCGTGAAGACAGACATTCTCGAGAATGTCTGTCTTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-533s21c1
Sequence:CCGGCGAGGATTACAGAGGAAACGTCTCGAGACGTTTCCTCTGTAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-374s21c1
Sequence:CCGGCCTATTCAGTGCCTATGATTACTCGAGTAATCATAGGCACTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-479s21c1
Sequence:CCGGACGTTCTGGCTTGGCTGTAAACTCGAGTTTACAGCCAAGCCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-729s21c1
Sequence:CCGGGCTGGAAGTATCTCGCTGTTTCTCGAGAAACAGCGAGATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023595.3-593s1c1
Sequence:CCGGCGTGCTGTTTAACTTTGGGAACTCGAGTTCCCAAAGTTAAACAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-566s1c1
Sequence:CCGGCGAGGATTACAGAGGAAACGTCTCGAGACGTTTCCTCTGTAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-762s1c1
Sequence:CCGGGCTGGAAGTATCTCGCTGTTTCTCGAGAAACAGCGAGATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-666s1c1
Sequence:CCGGCGGATTTCTTATCCAGACTTACTCGAGTAAGTCTGGATAAGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-450s1c1
Sequence:CCGGGCCATCGTGAAGACAGACATTCTCGAGAATGTCTGTCTTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023595
VALIDATED
DUT MISSION shRNA Lentiviral Transduction Particles
deoxyuridine triphosphatase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-417s21c1
Sequence:CCGGGCCATCGTGAAGACAGACATTCTCGAGAATGTCTGTCTTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-533s21c1
Sequence:CCGGCGAGGATTACAGAGGAAACGTCTCGAGACGTTTCCTCTGTAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-374s21c1
Sequence:CCGGCCTATTCAGTGCCTATGATTACTCGAGTAATCATAGGCACTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-479s21c1
Sequence:CCGGACGTTCTGGCTTGGCTGTAAACTCGAGTTTACAGCCAAGCCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023595.6-729s21c1
Sequence:CCGGGCTGGAAGTATCTCGCTGTTTCTCGAGAAACAGCGAGATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023595.3-593s1c1
Sequence:CCGGCGTGCTGTTTAACTTTGGGAACTCGAGTTCCCAAAGTTAAACAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-566s1c1
Sequence:CCGGCGAGGATTACAGAGGAAACGTCTCGAGACGTTTCCTCTGTAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-762s1c1
Sequence:CCGGGCTGGAAGTATCTCGCTGTTTCTCGAGAAACAGCGAGATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-666s1c1
Sequence:CCGGCGGATTTCTTATCCAGACTTACTCGAGTAAGTCTGGATAAGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023595.3-450s1c1
Sequence:CCGGGCCATCGTGAAGACAGACATTCTCGAGAATGTCTGTCTTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks