EMAIL THIS PAGE TO A FRIEND

DUX1

double homeobox 1

14 Gene Product Result for
Species: Human DUX1(26584)
UniProtKB ID: O43812
Gene ID:
Human(26584) Summary: The human genome contains hundreds of repeats of the 3.3-kb family in regions associated with heterochromatin. The DUX gene family, including DUX1, resides within these 3.3-kb repeated elements (Beckers et al., 2001 [PubMed 11245978]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302481 ANTI-DUX1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012146 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012146 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149998 predicted 395
2 SASI_Hs01_00149999 predicted 711
3 SASI_Hs01_00150000 predicted 868
4 SASI_Hs01_00150001 predicted 704
5 SASI_Hs01_00150004 predicted 858
6 SASI_Hs01_00150005 predicted 313
7 SASI_Hs01_00150006 predicted 924
8 SASI_Hs01_00150007 predicted 581
9 SASI_Hs01_00150002 predicted 405
10 SASI_Hs02_00343713 predicted 474
11 SASI_Hs01_00150003 predicted 408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012146
DUX1 MISSION shRNA Bacterial Glycerol Stock
double homeobox 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-168s1c1
Sequence:CCGGGAAGGCGAATGATACTCCTTTCTCGAGAAAGGAGTATCATTCGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-446s1c1
Sequence:CCGGGCCTTTGAGAAGGATCGCTTTCTCGAGAAAGCGATCCTTCTCAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-242s1c1
Sequence:CCGGCCGGGCATTGCCACCAAAGAACTCGAGTTCTTTGGTGGCAATGCCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-587s1c1
Sequence:CCGGCAGGCAAGCATCCGGTGCAATCTCGAGATTGCACCGGATGCTTGCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-369s1c1
Sequence:CCGGCCGGGAGACGTGACCCGCAAACTCGAGTTTGCGGGTCACGTCTCCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012146
DUX1 MISSION shRNA shRNA Plasmid DNA
double homeobox 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-168s1c1
Sequence:CCGGGAAGGCGAATGATACTCCTTTCTCGAGAAAGGAGTATCATTCGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-446s1c1
Sequence:CCGGGCCTTTGAGAAGGATCGCTTTCTCGAGAAAGCGATCCTTCTCAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-242s1c1
Sequence:CCGGCCGGGCATTGCCACCAAAGAACTCGAGTTCTTTGGTGGCAATGCCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-587s1c1
Sequence:CCGGCAGGCAAGCATCCGGTGCAATCTCGAGATTGCACCGGATGCTTGCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-369s1c1
Sequence:CCGGCCGGGAGACGTGACCCGCAAACTCGAGTTTGCGGGTCACGTCTCCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012146
DUX1 MISSION shRNA Lentiviral Transduction Particles
double homeobox 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-168s1c1
Sequence:CCGGGAAGGCGAATGATACTCCTTTCTCGAGAAAGGAGTATCATTCGCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-446s1c1
Sequence:CCGGGCCTTTGAGAAGGATCGCTTTCTCGAGAAAGCGATCCTTCTCAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-242s1c1
Sequence:CCGGCCGGGCATTGCCACCAAAGAACTCGAGTTCTTTGGTGGCAATGCCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-587s1c1
Sequence:CCGGCAGGCAAGCATCCGGTGCAATCTCGAGATTGCACCGGATGCTTGCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012146.1-369s1c1
Sequence:CCGGCCGGGAGACGTGACCCGCAAACTCGAGTTTGCGGGTCACGTCTCCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)