EMAIL THIS PAGE TO A FRIEND

DUX2

double homeobox 2

2 Gene Product Result for
Species: Human DUX2(26583)
UniProtKB ID: O75505
Gene ID:
Human(26583) Summary: The human genome contains hundreds of repeats of the 3.3-kb family in regions associated with heterochromatin. The DUX gene family, including DUX2, resides within these 3.3-kb repeated elements (Beckers et al., 2001 [PubMed 11245978]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012147 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012147
DUX2 MISSION shRNA Bacterial Glycerol Stock
double homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-85s1c1
Sequence:CCGGAGCCAAAGCAAGGCCCTACAACTCGAGTTGTAGGGCCTTGCTTTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-93s1c1
Sequence:CCGGCAAGGCCCTACAAGCCTGCTTCTCGAGAAGCAGGCTTGTAGGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-56s1c1
Sequence:CCGGGACAGCGAAGGAGACTCGTTTCTCGAGAAACGAGTCTCCTTCGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-92s1c1
Sequence:CCGGGCAAGGCCCTACAAGCCTGCTCTCGAGAGCAGGCTTGTAGGGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-84s1c1
Sequence:CCGGGAGCCAAAGCAAGGCCCTACACTCGAGTGTAGGGCCTTGCTTTGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012147
DUX2 MISSION shRNA shRNA Plasmid DNA
double homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-85s1c1
Sequence:CCGGAGCCAAAGCAAGGCCCTACAACTCGAGTTGTAGGGCCTTGCTTTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-93s1c1
Sequence:CCGGCAAGGCCCTACAAGCCTGCTTCTCGAGAAGCAGGCTTGTAGGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-56s1c1
Sequence:CCGGGACAGCGAAGGAGACTCGTTTCTCGAGAAACGAGTCTCCTTCGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-92s1c1
Sequence:CCGGGCAAGGCCCTACAAGCCTGCTCTCGAGAGCAGGCTTGTAGGGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-84s1c1
Sequence:CCGGGAGCCAAAGCAAGGCCCTACACTCGAGTGTAGGGCCTTGCTTTGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012147
DUX2 MISSION shRNA Lentiviral Transduction Particles
double homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-85s1c1
Sequence:CCGGAGCCAAAGCAAGGCCCTACAACTCGAGTTGTAGGGCCTTGCTTTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-93s1c1
Sequence:CCGGCAAGGCCCTACAAGCCTGCTTCTCGAGAAGCAGGCTTGTAGGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-56s1c1
Sequence:CCGGGACAGCGAAGGAGACTCGTTTCTCGAGAAACGAGTCTCCTTCGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-92s1c1
Sequence:CCGGGCAAGGCCCTACAAGCCTGCTCTCGAGAGCAGGCTTGTAGGGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012147.2-84s1c1
Sequence:CCGGGAGCCAAAGCAAGGCCCTACACTCGAGTGTAGGGCCTTGCTTTGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks