EMAIL THIS PAGE TO A FRIEND

DUX3

double homeobox 3

14 Gene Product Result for
Species: Human DUX3(26582)
UniProtKB ID: Q96PT4, Q9UND2
Gene ID:
Human(26582) Summary: The human genome contains hundreds of repeats of the 3.3-kb family in regions associated with heterochromatin. The DUX gene family, including DUX3, resides within these 3.3-kb repeated elements (Beckers et al., 2001 [PubMed 11245978]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012148 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012148 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343714 predicted 331
2 SASI_Hs02_00343715 predicted 335
3 SASI_Hs02_00343716 predicted 360
4 SASI_Hs02_00343717 predicted 280
5 SASI_Hs02_00343718 predicted 359
6 SASI_Hs02_00343719 predicted 371
7 SASI_Hs02_00343720 predicted 549
8 SASI_Hs02_00343721 predicted 162
9 SASI_Hs02_00343722 predicted 134
10 SASI_Hs02_00343723 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012148
DUX3 MISSION shRNA Bacterial Glycerol Stock
double homeobox 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-342s1c1
Sequence:CCGGGAAGGATCGCTTTCCAGGCATCTCGAGATGCCTGGAAAGCGATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-153s1c1
Sequence:CCGGGCTGGCCCAGGGCATCGACATCTCGAGATGTCGATGCCCTGGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-203s1c1
Sequence:CCGGAGAATGAGAGATCATGCCAGTCTCGAGACTGGCATGATCTCTCATTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-306s1c1
Sequence:CCGGCGGATCCCAAACCGCCCTGCTCTCGAGAGCAGGGCGGTTTGGGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-328s1c1
Sequence:CCGGCTCCGAGCCTTTGAGAAGGATCTCGAGATCCTTCTCAAAGGCTCGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012148
DUX3 MISSION shRNA shRNA Plasmid DNA
double homeobox 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-342s1c1
Sequence:CCGGGAAGGATCGCTTTCCAGGCATCTCGAGATGCCTGGAAAGCGATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-153s1c1
Sequence:CCGGGCTGGCCCAGGGCATCGACATCTCGAGATGTCGATGCCCTGGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-203s1c1
Sequence:CCGGAGAATGAGAGATCATGCCAGTCTCGAGACTGGCATGATCTCTCATTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-306s1c1
Sequence:CCGGCGGATCCCAAACCGCCCTGCTCTCGAGAGCAGGGCGGTTTGGGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-328s1c1
Sequence:CCGGCTCCGAGCCTTTGAGAAGGATCTCGAGATCCTTCTCAAAGGCTCGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012148
DUX3 MISSION shRNA Lentiviral Transduction Particles
double homeobox 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-342s1c1
Sequence:CCGGGAAGGATCGCTTTCCAGGCATCTCGAGATGCCTGGAAAGCGATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-153s1c1
Sequence:CCGGGCTGGCCCAGGGCATCGACATCTCGAGATGTCGATGCCCTGGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-203s1c1
Sequence:CCGGAGAATGAGAGATCATGCCAGTCTCGAGACTGGCATGATCTCTCATTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-306s1c1
Sequence:CCGGCGGATCCCAAACCGCCCTGCTCTCGAGAGCAGGGCGGTTTGGGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012148.1-328s1c1
Sequence:CCGGCTCCGAGCCTTTGAGAAGGATCTCGAGATCCTTCTCAAAGGCTCGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks