EMAIL THIS PAGE TO A FRIEND

DUX4

double homeobox 4

26 Gene Product Result for
Synonyms: DUX10
UniProtKB ID: Q9UBX2
Gene ID:
Human(22947) Summary: This gene is located within a D4Z4 repeat array in the subtelomeric region of chromosome 4q. The D4Z4 repeat is polymorphic in length; a similar D4Z4 repeat array has been identified on chromosome 10. Each D4Z4 repeat unit has an open reading frame (named DUX4) that encodes two homeoboxes; the repeat-array and ORF is conserved in other mammals. There is no evidence for transcription of this gene from standard cDNA libraries, however, RT-PCR and in vitro expression experiments indicate that the ORF is transcribed. The encoded protein has been reported to function as a transcriptional activator of paired-like homeodomain transcription factor 1 (PITX1; GeneID 5307). Contraction of the microsatellite repeat causes autosomal dominant facioscapulohumeral muscular dystrophy (FSHD). [provided by RefSeq, May 2013]
dog(491532) uncharacterized LOC491532
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033178 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033178 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360943 predicted 563
2 SASI_Hs02_00360944 predicted 571
3 SASI_Hs02_00360945 predicted 563
4 SASI_Hs02_00360946 predicted 1147
5 SASI_Hs02_00360947 predicted 1378
6 SASI_Hs02_00360948 predicted 1098
7 SASI_Hs02_00360949 predicted 563
8 SASI_Hs02_00360950 predicted 590
9 SASI_Hs01_00034152 predicted 579
10 SASI_Hs02_00360951 predicted 1042
11 SASI_Hs01_00034149 predicted 745
12 SASI_Hs01_00034150 predicted 747
13 SASI_Hs01_00034151 predicted 669
14 SASI_Hs01_00034153 predicted 484
15 SASI_Hs01_00034154 predicted 571
16 SASI_Hs01_00034155 predicted 742
17 SASI_Hs01_00034156 predicted 689
18 SASI_Hs01_00034157 predicted 539
19 SASI_Hs01_00034158 predicted 690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033178
DUX4 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-483s1c1
Sequence:CCGGCGAGTGGCTTTGCCCTCCCGACTCGAGTCGGGAGGGCAAAGCCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-742s1c1
Sequence:CCGGTCTGGTCTTCTACGTGGAAATCTCGAGATTTCCACGTAGAAGACCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-627s1c1
Sequence:CCGGGCTCTCCTTGCCAGGTTCCAACTCGAGTTGGAACCTGGCAAGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-754s1c1
Sequence:CCGGCGTGGAAATGAACGAGAGCCACTCGAGTGGCTCTCGTTCATTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-370s1c1
Sequence:CCGGCGCGGTTCACAGACCGCACATCTCGAGATGTGCGGTCTGTGAACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033178.2-703s21c1
Sequence:CCGGGAGTCCAGGATTCAGATCTGGCTCGAGCCAGATCTGAATCCTGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033178.2-491s21c1
Sequence:CCGGAGATTTGGTTTCAGAATGAGACTCGAGTCTCATTCTGAAACCAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033178
DUX4 MISSION shRNA shRNA Plasmid DNA
double homeobox 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-483s1c1
Sequence:CCGGCGAGTGGCTTTGCCCTCCCGACTCGAGTCGGGAGGGCAAAGCCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-742s1c1
Sequence:CCGGTCTGGTCTTCTACGTGGAAATCTCGAGATTTCCACGTAGAAGACCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-627s1c1
Sequence:CCGGGCTCTCCTTGCCAGGTTCCAACTCGAGTTGGAACCTGGCAAGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-754s1c1
Sequence:CCGGCGTGGAAATGAACGAGAGCCACTCGAGTGGCTCTCGTTCATTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-370s1c1
Sequence:CCGGCGCGGTTCACAGACCGCACATCTCGAGATGTGCGGTCTGTGAACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033178.2-703s21c1
Sequence:CCGGGAGTCCAGGATTCAGATCTGGCTCGAGCCAGATCTGAATCCTGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033178.2-491s21c1
Sequence:CCGGAGATTTGGTTTCAGAATGAGACTCGAGTCTCATTCTGAAACCAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033178
DUX4 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-483s1c1
Sequence:CCGGCGAGTGGCTTTGCCCTCCCGACTCGAGTCGGGAGGGCAAAGCCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-742s1c1
Sequence:CCGGTCTGGTCTTCTACGTGGAAATCTCGAGATTTCCACGTAGAAGACCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-627s1c1
Sequence:CCGGGCTCTCCTTGCCAGGTTCCAACTCGAGTTGGAACCTGGCAAGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-754s1c1
Sequence:CCGGCGTGGAAATGAACGAGAGCCACTCGAGTGGCTCTCGTTCATTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033178.1-370s1c1
Sequence:CCGGCGCGGTTCACAGACCGCACATCTCGAGATGTGCGGTCTGTGAACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033178.2-703s21c1
Sequence:CCGGGAGTCCAGGATTCAGATCTGGCTCGAGCCAGATCTGAATCCTGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033178.2-491s21c1
Sequence:CCGGAGATTTGGTTTCAGAATGAGACTCGAGTCTCATTCTGAAACCAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks