EMAIL THIS PAGE TO A FRIEND

DUX4L10

double homeobox 4 like 10

19 Gene Product Result for
Synonyms: DUX10
Species: Human DUX4L10(440013)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_495854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_495854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_495854 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_495854 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479900 predicted 562
2 SASI_Hs02_00479901 predicted 565
3 SASI_Hs02_00479902 predicted 561
4 SASI_Hs02_00479903 predicted 1138
5 SASI_Hs02_00479904 predicted 1368
6 SASI_Hs02_00479905 predicted 560
7 SASI_Hs01_00274696 predicted 574
8 SASI_Hs02_00479906 predicted 1039
9 SASI_Hs02_00479907 predicted 1062
10 SASI_Hs02_00479908 predicted 1065
11 SASI_Hs01_00274691 predicted 785
12 SASI_Hs01_00274692 predicted 781
13 SASI_Hs01_00274693 predicted 771
14 SASI_Hs01_00274694 predicted 786
15 SASI_Hs01_00274695 predicted 1791
16 SASI_Hs01_00274697 predicted 1514
17 SASI_Hs01_00274698 predicted 847
18 SASI_Hs01_00274699 predicted 952
19 SASI_Hs01_00274700 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_495854
DUX4L10 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4 like 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-476s21c1
Sequence:CCGGCCAGGGTCCAGATTTGGTTTCCTCGAGGAAACCAAATCTGGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-701s21c1
Sequence:CCGGCCAGGATTCAGATCTGGTTTCCTCGAGGAAACCAGATCTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-629s21c1
Sequence:CCGGCCTTTGAGAAGGATCGCTTTCCTCGAGGAAAGCGATCCTTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-486s21c1
Sequence:CCGGGATTTGGTTTCAGAATGAGAGCTCGAGCTCTCATTCTGAAACCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-711s21c1
Sequence:CCGGGATCTGGTTTCAGAATCGAAGCTCGAGCTTCGATTCTGAAACCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_495854
DUX4L10 MISSION shRNA shRNA Plasmid DNA
double homeobox 4 like 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-476s21c1
Sequence:CCGGCCAGGGTCCAGATTTGGTTTCCTCGAGGAAACCAAATCTGGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-701s21c1
Sequence:CCGGCCAGGATTCAGATCTGGTTTCCTCGAGGAAACCAGATCTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-629s21c1
Sequence:CCGGCCTTTGAGAAGGATCGCTTTCCTCGAGGAAAGCGATCCTTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-486s21c1
Sequence:CCGGGATTTGGTTTCAGAATGAGAGCTCGAGCTCTCATTCTGAAACCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-711s21c1
Sequence:CCGGGATCTGGTTTCAGAATCGAAGCTCGAGCTTCGATTCTGAAACCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_495854
DUX4L10 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4 like 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-476s21c1
Sequence:CCGGCCAGGGTCCAGATTTGGTTTCCTCGAGGAAACCAAATCTGGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-701s21c1
Sequence:CCGGCCAGGATTCAGATCTGGTTTCCTCGAGGAAACCAGATCTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-629s21c1
Sequence:CCGGCCTTTGAGAAGGATCGCTTTCCTCGAGGAAAGCGATCCTTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-486s21c1
Sequence:CCGGGATTTGGTTTCAGAATGAGAGCTCGAGCTCTCATTCTGAAACCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495854.4-711s21c1
Sequence:CCGGGATCTGGTTTCAGAATCGAAGCTCGAGCTTCGATTCTGAAACCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks