EMAIL THIS PAGE TO A FRIEND

DUX4L11

double homeobox 4 like 11

10 Gene Product Result for
Species: Human DUX4L11(399839)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_374852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374852 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720078 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00434368 predicted 563
2 SASI_Hs02_00434369 predicted 565
3 SASI_Hs02_00434370 predicted 561
4 SASI_Hs02_00434371 predicted 1140
5 SASI_Hs02_00434372 predicted 1364
6 SASI_Hs02_00434373 predicted 1089
7 SASI_Hs02_00434374 predicted 558
8 SASI_Hs02_00434375 predicted 582
9 SASI_Hs02_00434376 predicted 571
10 SASI_Hs02_00434377 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374852
DUX4L11 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4 like 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1819s1c1
Sequence:CCGGTCCAGGATTCAGATCTGGTTTCTCGAGAAACCAGATCTGAATCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1374s1c1
Sequence:CCGGCCCGCGTCCGTCCGTGAAATTCTCGAGAATTTCACGGACGGACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1829s1c1
Sequence:CCGGAGATCTGGTTTCAGAATCGAACTCGAGTTCGATTCTGAAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1609s1c1
Sequence:CCGGTGGTTTCAGAATGAGAGGTCACTCGAGTGACCTCTCATTCTGAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1418s1c1
Sequence:CCGGCCCTCCCGACACCTTCGGACACTCGAGTGTCCGAAGGTGTCGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374852
DUX4L11 MISSION shRNA shRNA Plasmid DNA
double homeobox 4 like 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1819s1c1
Sequence:CCGGTCCAGGATTCAGATCTGGTTTCTCGAGAAACCAGATCTGAATCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1374s1c1
Sequence:CCGGCCCGCGTCCGTCCGTGAAATTCTCGAGAATTTCACGGACGGACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1829s1c1
Sequence:CCGGAGATCTGGTTTCAGAATCGAACTCGAGTTCGATTCTGAAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1609s1c1
Sequence:CCGGTGGTTTCAGAATGAGAGGTCACTCGAGTGACCTCTCATTCTGAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1418s1c1
Sequence:CCGGCCCTCCCGACACCTTCGGACACTCGAGTGTCCGAAGGTGTCGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374852
DUX4L11 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4 like 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1819s1c1
Sequence:CCGGTCCAGGATTCAGATCTGGTTTCTCGAGAAACCAGATCTGAATCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1374s1c1
Sequence:CCGGCCCGCGTCCGTCCGTGAAATTCTCGAGAATTTCACGGACGGACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1829s1c1
Sequence:CCGGAGATCTGGTTTCAGAATCGAACTCGAGTTCGATTCTGAAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1609s1c1
Sequence:CCGGTGGTTTCAGAATGAGAGGTCACTCGAGTGACCTCTCATTCTGAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374852.1-1418s1c1
Sequence:CCGGCCCTCCCGACACCTTCGGACACTCGAGTGTCCGAAGGTGTCGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks