EMAIL THIS PAGE TO A FRIEND

DUX4L15

double homeobox 4 like 15

10 Gene Product Result for
Species: Human DUX4L15(440017)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_495858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_495858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_495858 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_495858 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479919 predicted 562
2 SASI_Hs02_00479920 predicted 562
3 SASI_Hs02_00479921 predicted 557
4 SASI_Hs02_00479922 predicted 1141
5 SASI_Hs02_00479923 predicted 1372
6 SASI_Hs02_00479924 predicted 558
7 SASI_Hs02_00479925 predicted 572
8 SASI_Hs02_00479926 predicted 1041
9 SASI_Hs02_00479927 predicted 1071
10 SASI_Hs02_00479928 predicted 1069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_495858
DUX4L15 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4 like 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-390s21c1
Sequence:CCGGAGGCCCTGCGAGCCTGCTTTGCTCGAGCAAAGCAGGCTCGCAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-450s21c1
Sequence:CCGGTGGCCCAGGCCATCGGCATTCCTCGAGGAATGCCGATGGCCTGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-1419s21c1
Sequence:CCGGTCCTGGCGAGCCCGGAGTTTCCTCGAGGAAACTCCGGGCTCGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-425s21c1
Sequence:CCGGCCGGGCATCGCCACCAGAGAACTCGAGTTCTCTGGTGGCGATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-352s21c1
Sequence:CCGGACGGCGACGGAGACTCGTTTGCTCGAGCAAACGAGTCTCCGTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_495858
DUX4L15 MISSION shRNA shRNA Plasmid DNA
double homeobox 4 like 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-390s21c1
Sequence:CCGGAGGCCCTGCGAGCCTGCTTTGCTCGAGCAAAGCAGGCTCGCAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-450s21c1
Sequence:CCGGTGGCCCAGGCCATCGGCATTCCTCGAGGAATGCCGATGGCCTGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-1419s21c1
Sequence:CCGGTCCTGGCGAGCCCGGAGTTTCCTCGAGGAAACTCCGGGCTCGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-425s21c1
Sequence:CCGGCCGGGCATCGCCACCAGAGAACTCGAGTTCTCTGGTGGCGATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-352s21c1
Sequence:CCGGACGGCGACGGAGACTCGTTTGCTCGAGCAAACGAGTCTCCGTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_495858
DUX4L15 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4 like 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-390s21c1
Sequence:CCGGAGGCCCTGCGAGCCTGCTTTGCTCGAGCAAAGCAGGCTCGCAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-450s21c1
Sequence:CCGGTGGCCCAGGCCATCGGCATTCCTCGAGGAATGCCGATGGCCTGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-1419s21c1
Sequence:CCGGTCCTGGCGAGCCCGGAGTTTCCTCGAGGAAACTCCGGGCTCGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-425s21c1
Sequence:CCGGCCGGGCATCGCCACCAGAGAACTCGAGTTCTCTGGTGGCGATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495858.4-352s21c1
Sequence:CCGGACGGCGACGGAGACTCGTTTGCTCGAGCAAACGAGTCTCCGTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks