EMAIL THIS PAGE TO A FRIEND

DUX4L2

double homeobox 4 like 2

12 Gene Product Result for
Synonyms: DUX4
Species: Human DUX4L2(728410)
UniProtKB ID: P0CJ85
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001127386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127386 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127386 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329344 predicted 556
2 SASI_Hs02_00329345 predicted 556
3 SASI_Hs02_00329346 predicted 560
4 SASI_Hs02_00329347 predicted 1137
5 SASI_Hs02_00329348 predicted 1372
6 SASI_Hs02_00329349 predicted 1091
7 SASI_Hs02_00329350 predicted 558
8 SASI_Hs02_00329351 predicted 589
9 SASI_Hs02_00329352 predicted 571
10 SASI_Hs02_00329353 predicted 1037
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127386
DUX4L2 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4 like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-713s21c1
Sequence:CCGGTCTGGTTTCAGAATCGAAGGGCTCGAGCCCTTCGATTCTGAAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-477s21c1
Sequence:CCGGCAGGGTCCAGATTTGGTTTCACTCGAGTGAAACCAAATCTGGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-702s21c1
Sequence:CCGGCAGGATTCAGATCTGGTTTCACTCGAGTGAAACCAGATCTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-630s21c1
Sequence:CCGGCTTTGAGAAGGATCGCTTTCCCTCGAGGGAAAGCGATCCTTCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-488s21c1
Sequence:CCGGTTTGGTTTCAGAATGAGAGGTCTCGAGACCTCTCATTCTGAAACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127386
DUX4L2 MISSION shRNA shRNA Plasmid DNA
double homeobox 4 like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-713s21c1
Sequence:CCGGTCTGGTTTCAGAATCGAAGGGCTCGAGCCCTTCGATTCTGAAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-477s21c1
Sequence:CCGGCAGGGTCCAGATTTGGTTTCACTCGAGTGAAACCAAATCTGGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-702s21c1
Sequence:CCGGCAGGATTCAGATCTGGTTTCACTCGAGTGAAACCAGATCTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-630s21c1
Sequence:CCGGCTTTGAGAAGGATCGCTTTCCCTCGAGGGAAAGCGATCCTTCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-488s21c1
Sequence:CCGGTTTGGTTTCAGAATGAGAGGTCTCGAGACCTCTCATTCTGAAACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127386
DUX4L2 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4 like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-713s21c1
Sequence:CCGGTCTGGTTTCAGAATCGAAGGGCTCGAGCCCTTCGATTCTGAAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-477s21c1
Sequence:CCGGCAGGGTCCAGATTTGGTTTCACTCGAGTGAAACCAAATCTGGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-702s21c1
Sequence:CCGGCAGGATTCAGATCTGGTTTCACTCGAGTGAAACCAGATCTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-630s21c1
Sequence:CCGGCTTTGAGAAGGATCGCTTTCCCTCGAGGGAAAGCGATCCTTCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127386.1-488s21c1
Sequence:CCGGTTTGGTTTCAGAATGAGAGGTCTCGAGACCTCTCATTCTGAAACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks