EMAIL THIS PAGE TO A FRIEND

DUX4L4

double homeobox 4 like 4

12 Gene Product Result for
Species: Human DUX4L4(441056)
UniProtKB ID: P0CJ87
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496731 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_496731 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480047 predicted 556
2 SASI_Hs02_00480048 predicted 564
3 SASI_Hs02_00480049 predicted 564
4 SASI_Hs02_00480050 predicted 1138
5 SASI_Hs02_00480051 predicted 1370
6 SASI_Hs02_00480052 predicted 1084
7 SASI_Hs02_00480053 predicted 557
8 SASI_Hs02_00480054 predicted 584
9 SASI_Hs02_00480055 predicted 576
10 SASI_Hs02_00480056 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496731
DUX4L4 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4 like 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-665s21c1
Sequence:CCGGGGGAGGAGCTGGCCAGAGAGACTCGAGTCTCTCTGGCCAGCTCCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-1396s21c1
Sequence:CCGGTGCGGCCTGCTGCTGGATGAGCTCGAGCTCATCCAGCAGCAGGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-1045s21c1
Sequence:CCGGCTCTCCCACCCTCAGGCTCCTCTCGAGAGGAGCCTGAGGGTGGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-689s21c1
Sequence:CCGGGCCTCCCGGAGTCCAGGATTCCTCGAGGAATCCTGGACTCCGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-912s21c1
Sequence:CCGGTTTCGTGAGCCAGGCAGCGAGCTCGAGCTCGCTGCCTGGCTCACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496731
DUX4L4 MISSION shRNA shRNA Plasmid DNA
double homeobox 4 like 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-665s21c1
Sequence:CCGGGGGAGGAGCTGGCCAGAGAGACTCGAGTCTCTCTGGCCAGCTCCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-1396s21c1
Sequence:CCGGTGCGGCCTGCTGCTGGATGAGCTCGAGCTCATCCAGCAGCAGGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-1045s21c1
Sequence:CCGGCTCTCCCACCCTCAGGCTCCTCTCGAGAGGAGCCTGAGGGTGGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-689s21c1
Sequence:CCGGGCCTCCCGGAGTCCAGGATTCCTCGAGGAATCCTGGACTCCGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-912s21c1
Sequence:CCGGTTTCGTGAGCCAGGCAGCGAGCTCGAGCTCGCTGCCTGGCTCACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496731
DUX4L4 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4 like 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-665s21c1
Sequence:CCGGGGGAGGAGCTGGCCAGAGAGACTCGAGTCTCTCTGGCCAGCTCCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-1396s21c1
Sequence:CCGGTGCGGCCTGCTGCTGGATGAGCTCGAGCTCATCCAGCAGCAGGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-1045s21c1
Sequence:CCGGCTCTCCCACCCTCAGGCTCCTCTCGAGAGGAGCCTGAGGGTGGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-689s21c1
Sequence:CCGGGCCTCCCGGAGTCCAGGATTCCTCGAGGAATCCTGGACTCCGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496731.4-912s21c1
Sequence:CCGGTTTCGTGAGCCAGGCAGCGAGCTCGAGCTCGCTGCCTGGCTCACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks