EMAIL THIS PAGE TO A FRIEND

DUX4L5

double homeobox 4 like 5

12 Gene Product Result for
Species: Human DUX4L5(653545)
UniProtKB ID: P0CJ88
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001127389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127389 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127389 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329374 predicted 561
2 SASI_Hs02_00329375 predicted 556
3 SASI_Hs02_00329376 predicted 555
4 SASI_Hs02_00329377 predicted 1135
5 SASI_Hs02_00329378 predicted 1370
6 SASI_Hs02_00329379 predicted 1088
7 SASI_Hs02_00329380 predicted 566
8 SASI_Hs02_00329381 predicted 588
9 SASI_Hs02_00329382 predicted 574
10 SASI_Hs02_00329383 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127389
DUX4L5 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4 like 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-632s21c1
Sequence:CCGGTTGAGAAGGATCGCTTTCCAGCTCGAGCTGGAAAGCGATCCTTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-696s21c1
Sequence:CCGGGGAGTCCAGGATTCAGATCTGCTCGAGCAGATCTGAATCCTGGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-620s21c1
Sequence:CCGGTCCTCCGAGCCTTTGAGAAGGCTCGAGCCTTCTCAAAGGCTCGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-482s21c1
Sequence:CCGGTCCAGATTTGGTTTCAGAATGCTCGAGCATTCTGAAACCAAATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-498s21c1
Sequence:CCGGGAATGAGAGGTCACGCCAGCTCTCGAGAGCTGGCGTGACCTCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127389
DUX4L5 MISSION shRNA shRNA Plasmid DNA
double homeobox 4 like 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-632s21c1
Sequence:CCGGTTGAGAAGGATCGCTTTCCAGCTCGAGCTGGAAAGCGATCCTTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-696s21c1
Sequence:CCGGGGAGTCCAGGATTCAGATCTGCTCGAGCAGATCTGAATCCTGGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-620s21c1
Sequence:CCGGTCCTCCGAGCCTTTGAGAAGGCTCGAGCCTTCTCAAAGGCTCGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-482s21c1
Sequence:CCGGTCCAGATTTGGTTTCAGAATGCTCGAGCATTCTGAAACCAAATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-498s21c1
Sequence:CCGGGAATGAGAGGTCACGCCAGCTCTCGAGAGCTGGCGTGACCTCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127389
DUX4L5 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4 like 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-632s21c1
Sequence:CCGGTTGAGAAGGATCGCTTTCCAGCTCGAGCTGGAAAGCGATCCTTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-696s21c1
Sequence:CCGGGGAGTCCAGGATTCAGATCTGCTCGAGCAGATCTGAATCCTGGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-620s21c1
Sequence:CCGGTCCTCCGAGCCTTTGAGAAGGCTCGAGCCTTCTCAAAGGCTCGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-482s21c1
Sequence:CCGGTCCAGATTTGGTTTCAGAATGCTCGAGCATTCTGAAACCAAATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127389.1-498s21c1
Sequence:CCGGGAATGAGAGGTCACGCCAGCTCTCGAGAGCTGGCGTGACCTCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks