EMAIL THIS PAGE TO A FRIEND

DUX4L6

double homeobox 4 like 6

12 Gene Product Result for
Species: Human DUX4L6(653544)
UniProtKB ID: P0CJ89
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001127388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127388 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127388 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329364 predicted 554
2 SASI_Hs02_00329365 predicted 558
3 SASI_Hs02_00329366 predicted 561
4 SASI_Hs02_00329367 predicted 1137
5 SASI_Hs02_00329368 predicted 1375
6 SASI_Hs02_00329369 predicted 1085
7 SASI_Hs02_00329370 predicted 563
8 SASI_Hs02_00329371 predicted 586
9 SASI_Hs02_00329372 predicted 575
10 SASI_Hs02_00329373 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127388
DUX4L6 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4 like 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-631s21c1
Sequence:CCGGTTTGAGAAGGATCGCTTTCCACTCGAGTGGAAAGCGATCCTTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-695s21c1
Sequence:CCGGCGGAGTCCAGGATTCAGATCTCTCGAGAGATCTGAATCCTGGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-492s21c1
Sequence:CCGGGTTTCAGAATGAGAGGTCACGCTCGAGCGTGACCTCTCATTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-707s21c1
Sequence:CCGGTTCAGATCTGGTTTCAGAATCCTCGAGGATTCTGAAACCAGATCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-478s21c1
Sequence:CCGGAGGGTCCAGATTTGGTTTCAGCTCGAGCTGAAACCAAATCTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127388
DUX4L6 MISSION shRNA shRNA Plasmid DNA
double homeobox 4 like 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-631s21c1
Sequence:CCGGTTTGAGAAGGATCGCTTTCCACTCGAGTGGAAAGCGATCCTTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-695s21c1
Sequence:CCGGCGGAGTCCAGGATTCAGATCTCTCGAGAGATCTGAATCCTGGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-492s21c1
Sequence:CCGGGTTTCAGAATGAGAGGTCACGCTCGAGCGTGACCTCTCATTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-707s21c1
Sequence:CCGGTTCAGATCTGGTTTCAGAATCCTCGAGGATTCTGAAACCAGATCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-478s21c1
Sequence:CCGGAGGGTCCAGATTTGGTTTCAGCTCGAGCTGAAACCAAATCTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127388
DUX4L6 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4 like 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-631s21c1
Sequence:CCGGTTTGAGAAGGATCGCTTTCCACTCGAGTGGAAAGCGATCCTTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-695s21c1
Sequence:CCGGCGGAGTCCAGGATTCAGATCTCTCGAGAGATCTGAATCCTGGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-492s21c1
Sequence:CCGGGTTTCAGAATGAGAGGTCACGCTCGAGCGTGACCTCTCATTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-707s21c1
Sequence:CCGGTTCAGATCTGGTTTCAGAATCCTCGAGGATTCTGAAACCAGATCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127388.1-478s21c1
Sequence:CCGGAGGGTCCAGATTTGGTTTCAGCTCGAGCTGAAACCAAATCTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks