EMAIL THIS PAGE TO A FRIEND

DUX4L7

double homeobox 4 like 7

Species: Human DUX4L7(653543)
UniProtKB ID: P0CJ90
Gene ID:
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001127387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127387 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127387 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329354 predicted 561
2 SASI_Hs02_00329355 predicted 565
3 SASI_Hs02_00329356 predicted 558
4 SASI_Hs02_00329357 predicted 1139
5 SASI_Hs02_00329358 predicted 1369
6 SASI_Hs02_00329359 predicted 1084
7 SASI_Hs02_00329360 predicted 557
8 SASI_Hs02_00329361 predicted 583
9 SASI_Hs02_00329362 predicted 569
10 SASI_Hs02_00329363 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127387
DUX4L7 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4 like 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-480s21c1
Sequence:CCGGGGTCCAGATTTGGTTTCAGAACTCGAGTTCTGAAACCAAATCTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-493s21c1
Sequence:CCGGTTTCAGAATGAGAGGTCACGCCTCGAGGCGTGACCTCTCATTCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-703s21c1
Sequence:CCGGAGGATTCAGATCTGGTTTCAGCTCGAGCTGAAACCAGATCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-692s21c1
Sequence:CCGGTCCCGGAGTCCAGGATTCAGACTCGAGTCTGAATCCTGGACTCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-627s21c1
Sequence:CCGGAGCCTTTGAGAAGGATCGCTTCTCGAGAAGCGATCCTTCTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127387
DUX4L7 MISSION shRNA shRNA Plasmid DNA
double homeobox 4 like 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-480s21c1
Sequence:CCGGGGTCCAGATTTGGTTTCAGAACTCGAGTTCTGAAACCAAATCTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-493s21c1
Sequence:CCGGTTTCAGAATGAGAGGTCACGCCTCGAGGCGTGACCTCTCATTCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-703s21c1
Sequence:CCGGAGGATTCAGATCTGGTTTCAGCTCGAGCTGAAACCAGATCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-692s21c1
Sequence:CCGGTCCCGGAGTCCAGGATTCAGACTCGAGTCTGAATCCTGGACTCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-627s21c1
Sequence:CCGGAGCCTTTGAGAAGGATCGCTTCTCGAGAAGCGATCCTTCTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127387
DUX4L7 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4 like 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-480s21c1
Sequence:CCGGGGTCCAGATTTGGTTTCAGAACTCGAGTTCTGAAACCAAATCTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-493s21c1
Sequence:CCGGTTTCAGAATGAGAGGTCACGCCTCGAGGCGTGACCTCTCATTCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-703s21c1
Sequence:CCGGAGGATTCAGATCTGGTTTCAGCTCGAGCTGAAACCAGATCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-692s21c1
Sequence:CCGGTCCCGGAGTCCAGGATTCAGACTCGAGTCTGAATCCTGGACTCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127387.1-627s21c1
Sequence:CCGGAGCCTTTGAGAAGGATCGCTTCTCGAGAAGCGATCCTTCTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks