EMAIL THIS PAGE TO A FRIEND

DUX5

double homeobox 5

13 Gene Product Result for
Synonyms: DUX1
Species: Human DUX5(26581)
UniProtKB ID: Q96PT3
Gene ID:
Human(26581) Summary: The human genome contains hundreds of repeats of the 3.3-kb family in regions associated with heterochromatin. The DUX gene family, including DUX5, resides within these 3.3-kb repeated elements (Beckers et al., 2001 [PubMed 11245978]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38960 Anti-DUX5 antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012149 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012149 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343724 predicted 362
2 SASI_Hs02_00343725 predicted 337
3 SASI_Hs02_00343726 predicted 335
4 SASI_Hs02_00343727 predicted 337
5 SASI_Hs02_00343728 predicted 281
6 SASI_Hs02_00343729 predicted 360
7 SASI_Hs02_00343730 predicted 366
8 SASI_Hs02_00343731 predicted 552
9 SASI_Hs02_00343732 predicted 169
10 SASI_Hs02_00343733 predicted 136
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012149
DUX5 MISSION shRNA Bacterial Glycerol Stock
double homeobox 5
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000017433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-196s1c1
Sequence:CCGGTGGTTTCAGAATGAGAGATCACTCGAGTGATCTCTCATTCTGAAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-282s1c1
Sequence:CCGGCAGACGAAAGCGGACTGCCATCTCGAGATGGCAGTCCGCTTTCGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-176s1c1
Sequence:CCGGCGGAGCCCAGGGTCCAGATTTCTCGAGAAATCTGGACCCTGGGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-360s1c1
Sequence:CCGGCATTGCTGCCAGGGAAGAGCTCTCGAGAGCTCTTCCCTGGCAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012149
DUX5 MISSION shRNA shRNA Plasmid DNA
double homeobox 5
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000017433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-196s1c1
Sequence:CCGGTGGTTTCAGAATGAGAGATCACTCGAGTGATCTCTCATTCTGAAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-282s1c1
Sequence:CCGGCAGACGAAAGCGGACTGCCATCTCGAGATGGCAGTCCGCTTTCGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-176s1c1
Sequence:CCGGCGGAGCCCAGGGTCCAGATTTCTCGAGAAATCTGGACCCTGGGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-360s1c1
Sequence:CCGGCATTGCTGCCAGGGAAGAGCTCTCGAGAGCTCTTCCCTGGCAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012149
DUX5 MISSION shRNA Lentiviral Transduction Particles
double homeobox 5
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000017433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-196s1c1
Sequence:CCGGTGGTTTCAGAATGAGAGATCACTCGAGTGATCTCTCATTCTGAAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-282s1c1
Sequence:CCGGCAGACGAAAGCGGACTGCCATCTCGAGATGGCAGTCCGCTTTCGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-176s1c1
Sequence:CCGGCGGAGCCCAGGGTCCAGATTTCTCGAGAAATCTGGACCCTGGGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012149.1-360s1c1
Sequence:CCGGCATTGCTGCCAGGGAAGAGCTCTCGAGAGCTCTTCCCTGGCAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks