EMAIL THIS PAGE TO A FRIEND

DUXA

double homeobox A

UniProtKB ID: A6NLW8
Gene ID:
Human(503835) Summary: Homeobox genes encode DNA-binding proteins, many of which are thought to be involved in early embryonic development. Homeobox genes encode a DNA-binding domain of 60 to 63 amino acids referred to as the homeodomain. This gene is a member of the DUXA homeobox gene family. Evidence of mRNA expression has not yet been found for this gene. Multiple, related processed pseudogenes have been found which are thought to reflect expression of this gene in the germ line or embryonic cells. [provided by RefSeq, Jul 2008]
Rat(100363299) double homeobox A
domestic cat(101100100) double homeobox A
cow(100297492) double homeobox A
Horse(100059378) double homeobox A
dog(484267) double homeobox A
sheep(101113006) double homeobox A
domestic guinea pig(101789129) double homeobox A
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012729 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012729 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085826 predicted 386
2 SASI_Hs01_00085827 predicted 457
3 SASI_Hs01_00085828 predicted 496
4 SASI_Hs01_00085829 predicted 337
5 SASI_Hs01_00085830 predicted 268
6 SASI_Hs01_00085831 predicted 265
7 SASI_Hs01_00085832 predicted 384
8 SASI_Hs01_00085833 predicted 379
9 SASI_Hs01_00085835 predicted 416
10 SASI_Hs02_00306236 predicted 422
11 SASI_Hs01_00085834 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012729
DUXA MISSION shRNA Bacterial Glycerol Stock
double homeobox A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-163s1c1
Sequence:CCGGCCAGGTTATGCTACCAAACAACTCGAGTTGTTTGGTAGCATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146938    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012729.1-1914s1c1
Sequence:CCGGCCCACCACAATAAAGCAAATACTCGAGTATTTGCTTTATTGTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-466s1c1
Sequence:CCGGCCAGAGTCAAGAGTCCAAATTCTCGAGAATTTGGACTCTTGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-538s1c1
Sequence:CCGGGTGGCGTCCTTAGAACAAGAACTCGAGTTCTTGTTCTAAGGACGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-374s1c1
Sequence:CCGGCCTCTCAGTTACACACTCTCACTCGAGTGAGAGTGTGTAACTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012729
DUXA MISSION shRNA shRNA Plasmid DNA
double homeobox A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-163s1c1
Sequence:CCGGCCAGGTTATGCTACCAAACAACTCGAGTTGTTTGGTAGCATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146938    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012729.1-1914s1c1
Sequence:CCGGCCCACCACAATAAAGCAAATACTCGAGTATTTGCTTTATTGTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-466s1c1
Sequence:CCGGCCAGAGTCAAGAGTCCAAATTCTCGAGAATTTGGACTCTTGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-538s1c1
Sequence:CCGGGTGGCGTCCTTAGAACAAGAACTCGAGTTCTTGTTCTAAGGACGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-374s1c1
Sequence:CCGGCCTCTCAGTTACACACTCTCACTCGAGTGAGAGTGTGTAACTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012729
DUXA MISSION shRNA Lentiviral Transduction Particles
double homeobox A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-163s1c1
Sequence:CCGGCCAGGTTATGCTACCAAACAACTCGAGTTGTTTGGTAGCATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146938    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012729.1-1914s1c1
Sequence:CCGGCCCACCACAATAAAGCAAATACTCGAGTATTTGCTTTATTGTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-466s1c1
Sequence:CCGGCCAGAGTCAAGAGTCCAAATTCTCGAGAATTTGGACTCTTGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-538s1c1
Sequence:CCGGGTGGCGTCCTTAGAACAAGAACTCGAGTTCTTGTTCTAAGGACGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012729.1-374s1c1
Sequence:CCGGCCTCTCAGTTACACACTCTCACTCGAGTGAGAGTGTGTAACTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks