EMAIL THIS PAGE TO A FRIEND

DVL2

dishevelled segment polarity protein 2

85 Gene Product Result for
UniProtKB ID: O14641, D3DTN3, Q53XM0
Gene ID:
Human(1856) Summary: This gene encodes a member of the dishevelled (dsh) protein family. The vertebrate dsh proteins have approximately 40% amino acid sequence similarity with Drosophila dsh. This gene encodes a 90-kD protein that undergoes posttranslational phosphorylation to form a 95-kD cytoplasmic protein, which may play a role in the signal transduction pathway mediated by multiple Wnt proteins. The mechanisms of dishevelled function in Wnt signaling are likely to be conserved among metazoans. [provided by RefSeq, Jul 2008]
Mouse(13543) dishevelled 2, dsh homolog (Drosophila)
Rat(303251) dishevelled 2
Zebrafish(323630) dishevelled, dsh homolog 2 (Drosophila)
domestic cat(101094385) dishevelled, dsh homolog 2 (Drosophila)
cow(614312) dishevelled, dsh homolog 2 (Drosophila)
Horse(100061612) dishevelled, dsh homolog 2 (Drosophila)
dog(489464) dishevelled, dsh homolog 2 (Drosophila)
naked mole-rat(101710629) dishevelled segment polarity protein 2
domestic guinea pig(100717450) dishevelled segment polarity protein 2
sheep(101117599) dishevelled, dsh homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004422 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004422 siRNAs that have been validated in the lab human pricing
NM_007888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004422 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104204 validated 1828
1 SASI_Hs01_00104203 validated 1983
2 SASI_Hs01_00104205 predicted 1475
3 SASI_Hs01_00104206 predicted 1492
4 SASI_Hs01_00104207 predicted 1782
5 SASI_Hs01_00104208 predicted 724
6 SASI_Hs01_00104209 predicted 1061
7 SASI_Hs01_00104210 predicted 1081
8 SASI_Hs01_00104211 predicted 1045
9 SASI_Hs01_00104212 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192668 predicted 413
2 SASI_Mm01_00192669 predicted 1745
3 SASI_Mm01_00192670 predicted 252
4 SASI_Mm01_00192671 predicted 1630
5 SASI_Mm01_00192672 predicted 2165
6 SASI_Mm01_00192673 predicted 1909
7 SASI_Mm01_00192674 predicted 620
8 SASI_Mm01_00192675 predicted 1647
9 SASI_Mm01_00192676 predicted 1663
10 SASI_Mm01_00192677 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004422
VALIDATED
DVL2 MISSION shRNA Bacterial Glycerol Stock
dishevelled segment polarity protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-454s1c1
Sequence:CCGGGAGACAGAAACCGAGTCAGTACTCGAGTACTGACTCGGTTTCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004422.1-810s1c1
Sequence:CCGGCACGCTAAACATGGAGAAGTACTCGAGTACTTCTCCATGTTTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-1552s1c1
Sequence:CCGGCTAGTCAACCTGTCTCTCAATCTCGAGATTGAGAGACAGGTTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-1205s1c1
Sequence:CCGGGCACCATTACATCTGGATCGTCTCGAGACGATCCAGATGTAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-2192s1c1
Sequence:CCGGGCGAGTTCTTTGTGGATGTTACTCGAGTAACATCCACAAAGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004422.2-2947s21c1
Sequence:CCGGGCTGCCTTTGTTACTCTATTTCTCGAGAAATAGAGTAACAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-1926s21c1
Sequence:CCGGGCCCACTTTCTCCTACCAATACTCGAGTATTGGTAGGAGAAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-730s21c1
Sequence:CCGGGAGACAGAAACCGAGTCAGTACTCGAGTACTGACTCGGTTTCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-1828s21c1
Sequence:CCGGCTAGTCAACCTGTCTCTCAATCTCGAGATTGAGAGACAGGTTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-1045s21c1
Sequence:CCGGAGCGTCACAGATTCCACAATGCTCGAGCATTGTGGAATCTGTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004422
VALIDATED
DVL2 MISSION shRNA shRNA Plasmid DNA
dishevelled segment polarity protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-454s1c1
Sequence:CCGGGAGACAGAAACCGAGTCAGTACTCGAGTACTGACTCGGTTTCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004422.1-810s1c1
Sequence:CCGGCACGCTAAACATGGAGAAGTACTCGAGTACTTCTCCATGTTTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-1552s1c1
Sequence:CCGGCTAGTCAACCTGTCTCTCAATCTCGAGATTGAGAGACAGGTTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-1205s1c1
Sequence:CCGGGCACCATTACATCTGGATCGTCTCGAGACGATCCAGATGTAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-2192s1c1
Sequence:CCGGGCGAGTTCTTTGTGGATGTTACTCGAGTAACATCCACAAAGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004422.2-2947s21c1
Sequence:CCGGGCTGCCTTTGTTACTCTATTTCTCGAGAAATAGAGTAACAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-1926s21c1
Sequence:CCGGGCCCACTTTCTCCTACCAATACTCGAGTATTGGTAGGAGAAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-730s21c1
Sequence:CCGGGAGACAGAAACCGAGTCAGTACTCGAGTACTGACTCGGTTTCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-1828s21c1
Sequence:CCGGCTAGTCAACCTGTCTCTCAATCTCGAGATTGAGAGACAGGTTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-1045s21c1
Sequence:CCGGAGCGTCACAGATTCCACAATGCTCGAGCATTGTGGAATCTGTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004422
VALIDATED
DVL2 MISSION shRNA Lentiviral Transduction Particles
dishevelled segment polarity protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-454s1c1
Sequence:CCGGGAGACAGAAACCGAGTCAGTACTCGAGTACTGACTCGGTTTCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004422.1-810s1c1
Sequence:CCGGCACGCTAAACATGGAGAAGTACTCGAGTACTTCTCCATGTTTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-1552s1c1
Sequence:CCGGCTAGTCAACCTGTCTCTCAATCTCGAGATTGAGAGACAGGTTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-1205s1c1
Sequence:CCGGGCACCATTACATCTGGATCGTCTCGAGACGATCCAGATGTAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004422.1-2192s1c1
Sequence:CCGGGCGAGTTCTTTGTGGATGTTACTCGAGTAACATCCACAAAGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004422.2-2947s21c1
Sequence:CCGGGCTGCCTTTGTTACTCTATTTCTCGAGAAATAGAGTAACAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-1926s21c1
Sequence:CCGGGCCCACTTTCTCCTACCAATACTCGAGTATTGGTAGGAGAAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-730s21c1
Sequence:CCGGGAGACAGAAACCGAGTCAGTACTCGAGTACTGACTCGGTTTCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-1828s21c1
Sequence:CCGGCTAGTCAACCTGTCTCTCAATCTCGAGATTGAGAGACAGGTTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004422.2-1045s21c1
Sequence:CCGGAGCGTCACAGATTCCACAATGCTCGAGCATTGTGGAATCTGTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007888
VALIDATED
DVL2 MISSION shRNA Bacterial Glycerol Stock
dishevelled segment polarity protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-1403s1c1
Sequence:CCGGCCTCATCTATGAGCACTATCACTCGAGTGATAGTGCTCATAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007888.2-2879s1c1
Sequence:CCGGGCTGCCTTTGTTACTCTATTTCTCGAGAAATAGAGTAACAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-1923s1c1
Sequence:CCGGCGAGCTTTCTTCGTACACCTACTCGAGTAGGTGTACGAAGAAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-451s1c1
Sequence:CCGGCCTTGCTTCAATGGAAGGGTTCTCGAGAACCCTTCCATTGAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-1748s1c1
Sequence:CCGGGCTGTGAGAGTTACCTAGTTACTCGAGTAACTAGGTAACTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007888.3-1293s21c1
Sequence:CCGGTACTTCACCCTCCCTCGAAATCTCGAGATTTCGAGGGAGGGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007888.3-2423s21c1
Sequence:CCGGACCCATCTTGAGGCCACATTGCTCGAGCAATGTGGCCTCAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007888.3-1855s21c1
Sequence:CCGGCCACCTTCTCCTACCAGTATCCTCGAGGATACTGGTAGGAGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007888.3-1742s21c1
Sequence:CCGGCTGTGAGAGTTACCTAGTTAACTCGAGTTAACTAGGTAACTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007888.3-241s21c1
Sequence:CCGGTAGGCGAGACGAAGGTGATTTCTCGAGAAATCACCTTCGTCTCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007888
VALIDATED
DVL2 MISSION shRNA shRNA Plasmid DNA
dishevelled segment polarity protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-1403s1c1
Sequence:CCGGCCTCATCTATGAGCACTATCACTCGAGTGATAGTGCTCATAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007888.2-2879s1c1
Sequence:CCGGGCTGCCTTTGTTACTCTATTTCTCGAGAAATAGAGTAACAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-1923s1c1
Sequence:CCGGCGAGCTTTCTTCGTACACCTACTCGAGTAGGTGTACGAAGAAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-451s1c1
Sequence:CCGGCCTTGCTTCAATGGAAGGGTTCTCGAGAACCCTTCCATTGAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-1748s1c1
Sequence:CCGGGCTGTGAGAGTTACCTAGTTACTCGAGTAACTAGGTAACTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007888.3-1293s21c1
Sequence:CCGGTACTTCACCCTCCCTCGAAATCTCGAGATTTCGAGGGAGGGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007888.3-2423s21c1
Sequence:CCGGACCCATCTTGAGGCCACATTGCTCGAGCAATGTGGCCTCAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007888.3-1855s21c1
Sequence:CCGGCCACCTTCTCCTACCAGTATCCTCGAGGATACTGGTAGGAGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007888.3-1742s21c1
Sequence:CCGGCTGTGAGAGTTACCTAGTTAACTCGAGTTAACTAGGTAACTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007888.3-241s21c1
Sequence:CCGGTAGGCGAGACGAAGGTGATTTCTCGAGAAATCACCTTCGTCTCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007888
VALIDATED
DVL2 MISSION shRNA Lentiviral Transduction Particles
dishevelled segment polarity protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-1403s1c1
Sequence:CCGGCCTCATCTATGAGCACTATCACTCGAGTGATAGTGCTCATAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007888.2-2879s1c1
Sequence:CCGGGCTGCCTTTGTTACTCTATTTCTCGAGAAATAGAGTAACAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-1923s1c1
Sequence:CCGGCGAGCTTTCTTCGTACACCTACTCGAGTAGGTGTACGAAGAAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-451s1c1
Sequence:CCGGCCTTGCTTCAATGGAAGGGTTCTCGAGAACCCTTCCATTGAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007888.2-1748s1c1
Sequence:CCGGGCTGTGAGAGTTACCTAGTTACTCGAGTAACTAGGTAACTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007888.3-1293s21c1
Sequence:CCGGTACTTCACCCTCCCTCGAAATCTCGAGATTTCGAGGGAGGGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007888.3-2423s21c1
Sequence:CCGGACCCATCTTGAGGCCACATTGCTCGAGCAATGTGGCCTCAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007888.3-1855s21c1
Sequence:CCGGCCACCTTCTCCTACCAGTATCCTCGAGGATACTGGTAGGAGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007888.3-1742s21c1
Sequence:CCGGCTGTGAGAGTTACCTAGTTAACTCGAGTTAACTAGGTAACTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007888.3-241s21c1
Sequence:CCGGTAGGCGAGACGAAGGTGATTTCTCGAGAAATCACCTTCGTCTCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks