EMAIL THIS PAGE TO A FRIEND

DVL3

dishevelled segment polarity protein 3

59 Gene Product Result for
UniProtKB ID: Q92997, D3DNT0, O14642, Q13531, Q8N5E9, Q92607
Gene ID:
Human(1857) Summary: This gene is a member of a multi-gene family which shares strong similarity with the Drosophila dishevelled gene, dsh. The Drosophila dishevelled gene encodes a cytoplasmic phosphoprotein that regulates cell proliferation. [provided by RefSeq, Jul 2008]
Mouse(13544) dishevelled 3, dsh homolog (Drosophila)
Rat(303811) dishevelled segment polarity protein 3
chicken(424949) dishevelled, dsh homolog 3 (Drosophila)
dog(478650) dishevelled, dsh homolog 3 (Drosophila)
domestic cat(101095675) dishevelled, dsh homolog 3 (Drosophila)
cow(539203) dishevelled segment polarity protein 3
sheep(101107926) dishevelled, dsh homolog 3 (Drosophila)
domestic guinea pig(100723761) dishevelled segment polarity protein 3
naked mole-rat(101716996) dishevelled segment polarity protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004423 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU062601 MISSION® esiRNA esiRNA targeting mouse Dvl3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004423 siRNAs that have been validated in the lab human pricing
NM_001107081 Rosetta Predictions rat pricing
NM_007889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004423 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042033 validated 1604
2 SASI_Hs01_00042032 predicted 1027
3 SASI_Hs01_00042035 predicted 2666
4 SASI_Hs02_00337586 predicted 2735
5 SASI_Hs01_00042036 predicted 2687
6 SASI_Hs01_00042037 predicted 1527
7 SASI_Hs01_00042038 predicted 2397
8 SASI_Hs01_00042039 predicted 923
9 SASI_Hs01_00042040 predicted 866
10 SASI_Hs01_00042041 predicted 1470
11 SASI_Hs01_00042034 predicted 2683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225306 predicted 1659
2 SASI_Rn02_00225307 predicted 1966
3 SASI_Rn02_00225308 predicted 1071
4 SASI_Rn02_00225309 predicted 1093
5 SASI_Rn02_00225310 predicted 1373
6 SASI_Rn02_00225311 predicted 970
7 SASI_Rn02_00225312 predicted 910
8 SASI_Rn02_00225313 predicted 1482
9 SASI_Rn02_00225314 predicted 598
10 SASI_Rn02_00225315 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131740 predicted 1599
2 SASI_Mm01_00131741 predicted 302
3 SASI_Mm01_00131742 predicted 592
4 SASI_Mm01_00131743 predicted 1015
5 SASI_Mm02_00312676 predicted 1010
6 SASI_Mm02_00312677 predicted 919
7 SASI_Mm01_00131745 predicted 1421
8 SASI_Mm01_00131739 predicted 1515
9 SASI_Mm01_00131746 predicted 1060
10 SASI_Mm01_00131744 predicted 1622
11 SASI_Mm01_00131747 predicted 1444
12 SASI_Mm01_00131748 predicted 1620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004423
VALIDATED
DVL3 MISSION shRNA Bacterial Glycerol Stock
dishevelled segment polarity protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-278s21c1
Sequence:CCGGCAAGTCTATGGACGACGATTTCTCGAGAAATCGTCGTCCATAGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-333s21c1
Sequence:CCGGGCCAAGCTACCATGCTTCAATCTCGAGATTGAAGCATGGTAGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004423.3-2673s21c1
Sequence:CCGGTAGCTCCCTTTCACCATTTATCTCGAGATAAATGGTGAAAGGGAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-1370s21c1
Sequence:CCGGTGACATGGCTGCCATCGTAAACTCGAGTTTACGATGGCAGCCATGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-221s21c1
Sequence:CCGGCGTCACCTTGGCGGACTTTAACTCGAGTTAAAGTCCGCCAAGGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-254s1c1
Sequence:CCGGGCGACCCAGCTATAAGTTCTTCTCGAGAAGAACTTATAGCTGGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004423.3-608s1c1
Sequence:CCGGCCGGCTAAATGGAACTGCGAACTCGAGTTCGCAGTTCCATTTAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-1455s1c1
Sequence:CCGGCCTAATGCTTTCATCGGCTCACTCGAGTGAGCCGATGAAAGCATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-333s1c1
Sequence:CCGGGCCAAGCTACCATGCTTCAATCTCGAGATTGAAGCATGGTAGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-1041s1c1
Sequence:CCGGCAGGTAAACGAGATCAACTTTCTCGAGAAAGTTGATCTCGTTTACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004423
VALIDATED
DVL3 MISSION shRNA shRNA Plasmid DNA
dishevelled segment polarity protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-278s21c1
Sequence:CCGGCAAGTCTATGGACGACGATTTCTCGAGAAATCGTCGTCCATAGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-333s21c1
Sequence:CCGGGCCAAGCTACCATGCTTCAATCTCGAGATTGAAGCATGGTAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004423.3-2673s21c1
Sequence:CCGGTAGCTCCCTTTCACCATTTATCTCGAGATAAATGGTGAAAGGGAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-1370s21c1
Sequence:CCGGTGACATGGCTGCCATCGTAAACTCGAGTTTACGATGGCAGCCATGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-221s21c1
Sequence:CCGGCGTCACCTTGGCGGACTTTAACTCGAGTTAAAGTCCGCCAAGGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-254s1c1
Sequence:CCGGGCGACCCAGCTATAAGTTCTTCTCGAGAAGAACTTATAGCTGGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004423.3-608s1c1
Sequence:CCGGCCGGCTAAATGGAACTGCGAACTCGAGTTCGCAGTTCCATTTAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-1455s1c1
Sequence:CCGGCCTAATGCTTTCATCGGCTCACTCGAGTGAGCCGATGAAAGCATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-333s1c1
Sequence:CCGGGCCAAGCTACCATGCTTCAATCTCGAGATTGAAGCATGGTAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-1041s1c1
Sequence:CCGGCAGGTAAACGAGATCAACTTTCTCGAGAAAGTTGATCTCGTTTACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004423
VALIDATED
DVL3 MISSION shRNA Lentiviral Transduction Particles
dishevelled segment polarity protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-278s21c1
Sequence:CCGGCAAGTCTATGGACGACGATTTCTCGAGAAATCGTCGTCCATAGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-333s21c1
Sequence:CCGGGCCAAGCTACCATGCTTCAATCTCGAGATTGAAGCATGGTAGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004423.3-2673s21c1
Sequence:CCGGTAGCTCCCTTTCACCATTTATCTCGAGATAAATGGTGAAAGGGAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-1370s21c1
Sequence:CCGGTGACATGGCTGCCATCGTAAACTCGAGTTTACGATGGCAGCCATGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004423.3-221s21c1
Sequence:CCGGCGTCACCTTGGCGGACTTTAACTCGAGTTAAAGTCCGCCAAGGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-254s1c1
Sequence:CCGGGCGACCCAGCTATAAGTTCTTCTCGAGAAGAACTTATAGCTGGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004423.3-608s1c1
Sequence:CCGGCCGGCTAAATGGAACTGCGAACTCGAGTTCGCAGTTCCATTTAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-1455s1c1
Sequence:CCGGCCTAATGCTTTCATCGGCTCACTCGAGTGAGCCGATGAAAGCATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-333s1c1
Sequence:CCGGGCCAAGCTACCATGCTTCAATCTCGAGATTGAAGCATGGTAGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004423.3-1041s1c1
Sequence:CCGGCAGGTAAACGAGATCAACTTTCTCGAGAAAGTTGATCTCGTTTACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007889
DVL3 MISSION shRNA Bacterial Glycerol Stock
dishevelled segment polarity protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-762s1c1
Sequence:CCGGGCTGGAGACTACCAGTTTCTTCTCGAGAAGAAACTGGTAGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-1512s1c1
Sequence:CCGGGCTCAAGATTACCATTCCCAACTCGAGTTGGGAATGGTAATCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-725s1c1
Sequence:CCGGGCGGCTATGACAGTTCATCTACTCGAGTAGATGAACTGTCATAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-330s1c1
Sequence:CCGGGCCCAGCTATAAGTTCTTCTTCTCGAGAAGAAGAACTTATAGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-763s1c1
Sequence:CCGGCTGGAGACTACCAGTTTCTTTCTCGAGAAAGAAACTGGTAGTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007889
DVL3 MISSION shRNA shRNA Plasmid DNA
dishevelled segment polarity protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-762s1c1
Sequence:CCGGGCTGGAGACTACCAGTTTCTTCTCGAGAAGAAACTGGTAGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-1512s1c1
Sequence:CCGGGCTCAAGATTACCATTCCCAACTCGAGTTGGGAATGGTAATCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-725s1c1
Sequence:CCGGGCGGCTATGACAGTTCATCTACTCGAGTAGATGAACTGTCATAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-330s1c1
Sequence:CCGGGCCCAGCTATAAGTTCTTCTTCTCGAGAAGAAGAACTTATAGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-763s1c1
Sequence:CCGGCTGGAGACTACCAGTTTCTTTCTCGAGAAAGAAACTGGTAGTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007889
DVL3 MISSION shRNA Lentiviral Transduction Particles
dishevelled segment polarity protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-762s1c1
Sequence:CCGGGCTGGAGACTACCAGTTTCTTCTCGAGAAGAAACTGGTAGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-1512s1c1
Sequence:CCGGGCTCAAGATTACCATTCCCAACTCGAGTTGGGAATGGTAATCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-725s1c1
Sequence:CCGGGCGGCTATGACAGTTCATCTACTCGAGTAGATGAACTGTCATAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-330s1c1
Sequence:CCGGGCCCAGCTATAAGTTCTTCTTCTCGAGAAGAAGAACTTATAGCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007889.1-763s1c1
Sequence:CCGGCTGGAGACTACCAGTTTCTTTCTCGAGAAAGAAACTGGTAGTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)