EMAIL THIS PAGE TO A FRIEND

DXO

decapping exoribonuclease

21 Gene Product Result for
Synonyms: DOM3L DOM3Z NG6 RAI1
Species: Human DXO(1797)
Gene ID:
Human(1797) Summary: This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. The function of its protein product is unknown, but its ubiquitous expression and conservation in both simple and complex eukaryotes suggests that this may be a housekeeping gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005510 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005510 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234688 predicted 477
2 SASI_Hs01_00234689 predicted 1092
3 SASI_Hs01_00234690 predicted 806
4 SASI_Hs01_00234691 predicted 1247
5 SASI_Hs01_00234692 predicted 908
6 SASI_Hs01_00234693 predicted 1195
7 SASI_Hs01_00234694 predicted 892
8 SASI_Hs01_00234695 predicted 583
9 SASI_Hs01_00234696 predicted 790
10 SASI_Hs02_00339724 predicted 826
11 SASI_Hs01_00234697 predicted 885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005510
VALIDATED
DXO MISSION shRNA Bacterial Glycerol Stock
decapping exoribonuclease
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-884s21c1
Sequence:CCGGTTATGTACATGGGATACAAATCTCGAGATTTGTATCCCATGTACATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-744s21c1
Sequence:CCGGACTGCTGACGACACCGTATGACTCGAGTCATACGGTGTCGTCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005510.3-1198s21c1
Sequence:CCGGGTTGTTGCTGGCTTCCGTAACCTCGAGGTTACGGAAGCCAGCAACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-1140s21c1
Sequence:CCGGCTACAGACACAAGCTCCTGAACTCGAGTTCAGGAGCTTGTGTCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-377s21c1
Sequence:CCGGTAGCTGAGCCTCGGAACAAACCTCGAGGTTTGTTCCGAGGCTCAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.2-1066s1c1
Sequence:CCGGGAATATGTCAGGAATGACCGTCTCGAGACGGTCATTCCTGACATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005510.3-1140s1c1
Sequence:CCGGCTACAGACACAAGCTCCTGAACTCGAGTTCAGGAGCTTGTGTCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005510.2-705s1c1
Sequence:CCGGGCAGTACATGTGTGCAGACAACTCGAGTTGTCTGCACACATGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005510.3-802s1c1
Sequence:CCGGCAGGGAACACTATACCTGAGTCTCGAGACTCAGGTATAGTGTTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005510.2-372s1c1
Sequence:CCGGCTTTGACCTCAGAGACGGATACTCGAGTATCCGTCTCTGAGGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.2-1176s1c1
Sequence:CCGGCGTTCATCTCTTCTCTTGGGACTCGAGTCCCAAGAGAAGAGATGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005510.3-1299s1c1
Sequence:CCGGGAATCCCTCTGTGTGCATGAACTCGAGTTCATGCACACAGAGGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.3-1134s1c1
Sequence:CCGGGAGTTTCTACAGACACAAGCTCTCGAGAGCTTGTGTCTGTAGAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.2-1048s1c1
Sequence:CCGGCCTACCATGAAGATGTTTGAACTCGAGTTCAAACATCTTCATGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005510
VALIDATED
DXO MISSION shRNA shRNA Plasmid DNA
decapping exoribonuclease
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-884s21c1
Sequence:CCGGTTATGTACATGGGATACAAATCTCGAGATTTGTATCCCATGTACATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-744s21c1
Sequence:CCGGACTGCTGACGACACCGTATGACTCGAGTCATACGGTGTCGTCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005510.3-1198s21c1
Sequence:CCGGGTTGTTGCTGGCTTCCGTAACCTCGAGGTTACGGAAGCCAGCAACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-1140s21c1
Sequence:CCGGCTACAGACACAAGCTCCTGAACTCGAGTTCAGGAGCTTGTGTCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-377s21c1
Sequence:CCGGTAGCTGAGCCTCGGAACAAACCTCGAGGTTTGTTCCGAGGCTCAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.2-1066s1c1
Sequence:CCGGGAATATGTCAGGAATGACCGTCTCGAGACGGTCATTCCTGACATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005510.3-1140s1c1
Sequence:CCGGCTACAGACACAAGCTCCTGAACTCGAGTTCAGGAGCTTGTGTCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005510.2-705s1c1
Sequence:CCGGGCAGTACATGTGTGCAGACAACTCGAGTTGTCTGCACACATGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005510.3-802s1c1
Sequence:CCGGCAGGGAACACTATACCTGAGTCTCGAGACTCAGGTATAGTGTTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005510.2-372s1c1
Sequence:CCGGCTTTGACCTCAGAGACGGATACTCGAGTATCCGTCTCTGAGGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.2-1176s1c1
Sequence:CCGGCGTTCATCTCTTCTCTTGGGACTCGAGTCCCAAGAGAAGAGATGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005510.3-1299s1c1
Sequence:CCGGGAATCCCTCTGTGTGCATGAACTCGAGTTCATGCACACAGAGGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.3-1134s1c1
Sequence:CCGGGAGTTTCTACAGACACAAGCTCTCGAGAGCTTGTGTCTGTAGAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.2-1048s1c1
Sequence:CCGGCCTACCATGAAGATGTTTGAACTCGAGTTCAAACATCTTCATGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005510
VALIDATED
DXO MISSION shRNA Lentiviral Transduction Particles
decapping exoribonuclease
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-884s21c1
Sequence:CCGGTTATGTACATGGGATACAAATCTCGAGATTTGTATCCCATGTACATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-744s21c1
Sequence:CCGGACTGCTGACGACACCGTATGACTCGAGTCATACGGTGTCGTCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005510.3-1198s21c1
Sequence:CCGGGTTGTTGCTGGCTTCCGTAACCTCGAGGTTACGGAAGCCAGCAACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-1140s21c1
Sequence:CCGGCTACAGACACAAGCTCCTGAACTCGAGTTCAGGAGCTTGTGTCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005510.3-377s21c1
Sequence:CCGGTAGCTGAGCCTCGGAACAAACCTCGAGGTTTGTTCCGAGGCTCAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.2-1066s1c1
Sequence:CCGGGAATATGTCAGGAATGACCGTCTCGAGACGGTCATTCCTGACATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005510.3-1140s1c1
Sequence:CCGGCTACAGACACAAGCTCCTGAACTCGAGTTCAGGAGCTTGTGTCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005510.2-705s1c1
Sequence:CCGGGCAGTACATGTGTGCAGACAACTCGAGTTGTCTGCACACATGTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005510.3-802s1c1
Sequence:CCGGCAGGGAACACTATACCTGAGTCTCGAGACTCAGGTATAGTGTTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005510.2-372s1c1
Sequence:CCGGCTTTGACCTCAGAGACGGATACTCGAGTATCCGTCTCTGAGGTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.2-1176s1c1
Sequence:CCGGCGTTCATCTCTTCTCTTGGGACTCGAGTCCCAAGAGAAGAGATGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005510.3-1299s1c1
Sequence:CCGGGAATCCCTCTGTGTGCATGAACTCGAGTTCATGCACACAGAGGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.3-1134s1c1
Sequence:CCGGGAGTTTCTACAGACACAAGCTCTCGAGAGCTTGTGTCTGTAGAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005510.2-1048s1c1
Sequence:CCGGCCTACCATGAAGATGTTTGAACTCGAGTTCAAACATCTTCATGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)