EMAIL THIS PAGE TO A FRIEND

DYDC1

DPY30 domain containing 1

85 Gene Product Result for
Synonyms: DPY30D1
UniProtKB ID: Q8WWB3, Q5QP03, Q5QP04, Q6WNP4, Q6ZU87
Gene ID:
Human(143241) Summary: This gene encodes a member of a family of proteins that contains a DPY30 domain. The encoded protein is involved in acrosome formation during spermatid development. This gene locus overlaps with a closely related gene on the opposite strand. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(69496) DPY30 domain containing 1
Rat(688433) DPY30 domain containing 1
chicken(423627) DPY30 domain containing 1
dog(100687851) DPY30 domain containing 1
cow(613509) DPY30 domain containing 1
domestic cat(101080326) DPY30 domain containing 1
sheep(101108020) DPY30 domain containing 1
naked mole-rat(101713804) DPY30 domain containing 1
domestic guinea pig(100728402) DPY30 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138812 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138812 Rosetta Predictions human pricing
XM_001066918 Rosetta Predictions rat pricing
XM_127632 Rosetta Predictions mouse pricing
XM_911778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192394 predicted 390
2 SASI_Hs01_00192395 predicted 385
3 SASI_Hs01_00192396 predicted 425
4 SASI_Hs01_00192397 predicted 379
5 SASI_Hs01_00192398 predicted 416
6 SASI_Hs01_00192399 predicted 459
7 SASI_Hs01_00192401 predicted 390
8 SASI_Hs02_00363975 predicted 458
9 SASI_Hs01_00192402 predicted 416
10 SASI_Hs01_00192403 predicted 494
11 SASI_Hs01_00192400 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319212 predicted 296
2 SASI_Rn02_00319213 predicted 330
3 SASI_Rn02_00319214 predicted 429
4 SASI_Rn02_00319215 predicted 191
5 SASI_Rn02_00319216 predicted 228
6 SASI_Rn02_00319217 predicted 476
7 SASI_Rn02_00319218 predicted 296
8 SASI_Rn02_00319219 predicted 452
9 SASI_Rn02_00319220 predicted 218
10 SASI_Rn02_00319221 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260751 predicted 625
2 SASI_Mm01_00260752 predicted 636
3 SASI_Mm01_00260753 predicted 707
4 SASI_Mm02_00424234 predicted 637
5 SASI_Mm02_00424235 predicted 699
6 SASI_Mm01_00260755 predicted 693
7 SASI_Mm01_00260758 predicted 604
8 SASI_Mm01_00260759 predicted 680
9 SASI_Mm01_00260760 predicted 677
10 SASI_Mm02_00424236 predicted 661
11 SASI_Mm01_00260754 predicted 687
12 SASI_Mm01_00260756 predicted 630
13 SASI_Mm01_00260757 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436623 predicted 572
2 SASI_Mm02_00436624 predicted 368
3 SASI_Mm02_00436625 predicted 700
4 SASI_Mm02_00436626 predicted 690
5 SASI_Mm02_00436627 predicted 224
6 SASI_Mm02_00436628 predicted 293
7 SASI_Mm02_00436629 predicted 210
8 SASI_Mm02_00436630 predicted 530
9 SASI_Mm02_00436631 predicted 230
10 SASI_Mm02_00436632 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138812
DYDC1 MISSION shRNA Bacterial Glycerol Stock
DPY30 domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-477s1c1
Sequence:CCGGCAAGAACTACAGAGAGCTCAACTCGAGTTGAGCTCTCTGTAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-204s1c1
Sequence:CCGGGCCTGTTTAACTCAAGGTCTTCTCGAGAAGACCTTGAGTTAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-246s1c1
Sequence:CCGGCCAGTGGATCCGATAGAATATCTCGAGATATTCTATCGGATCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-508s1c1
Sequence:CCGGGCAAGGAGATGAGAATGAATACTCGAGTATTCATTCTCATCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-600s1c1
Sequence:CCGGGCTGAAATCAGCGATCGTTATCTCGAGATAACGATCGCTGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-552s1c1
Sequence:CCGGGATATTCTACATTCAGAGGAACTCGAGTTCCTCTGAATGTAGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138812.2-336s21c1
Sequence:CCGGGGAGCGTGAAAGAGAATTAGCCTCGAGGCTAATTCTCTTTCACGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138812.2-266s21c1
Sequence:CCGGCATTGTGGATTTACAAGTATACTCGAGTATACTTGTAAATCCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138812.2-643s21c1
Sequence:CCGGGAACTTGATGAACCAATGTTTCTCGAGAAACATTGGTTCATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138812
DYDC1 MISSION shRNA shRNA Plasmid DNA
DPY30 domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-477s1c1
Sequence:CCGGCAAGAACTACAGAGAGCTCAACTCGAGTTGAGCTCTCTGTAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-204s1c1
Sequence:CCGGGCCTGTTTAACTCAAGGTCTTCTCGAGAAGACCTTGAGTTAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-246s1c1
Sequence:CCGGCCAGTGGATCCGATAGAATATCTCGAGATATTCTATCGGATCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-508s1c1
Sequence:CCGGGCAAGGAGATGAGAATGAATACTCGAGTATTCATTCTCATCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-600s1c1
Sequence:CCGGGCTGAAATCAGCGATCGTTATCTCGAGATAACGATCGCTGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-552s1c1
Sequence:CCGGGATATTCTACATTCAGAGGAACTCGAGTTCCTCTGAATGTAGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138812.2-336s21c1
Sequence:CCGGGGAGCGTGAAAGAGAATTAGCCTCGAGGCTAATTCTCTTTCACGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138812.2-266s21c1
Sequence:CCGGCATTGTGGATTTACAAGTATACTCGAGTATACTTGTAAATCCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138812.2-643s21c1
Sequence:CCGGGAACTTGATGAACCAATGTTTCTCGAGAAACATTGGTTCATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138812
DYDC1 MISSION shRNA Lentiviral Transduction Particles
DPY30 domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-477s1c1
Sequence:CCGGCAAGAACTACAGAGAGCTCAACTCGAGTTGAGCTCTCTGTAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-204s1c1
Sequence:CCGGGCCTGTTTAACTCAAGGTCTTCTCGAGAAGACCTTGAGTTAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-246s1c1
Sequence:CCGGCCAGTGGATCCGATAGAATATCTCGAGATATTCTATCGGATCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-508s1c1
Sequence:CCGGGCAAGGAGATGAGAATGAATACTCGAGTATTCATTCTCATCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-600s1c1
Sequence:CCGGGCTGAAATCAGCGATCGTTATCTCGAGATAACGATCGCTGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138812.1-552s1c1
Sequence:CCGGGATATTCTACATTCAGAGGAACTCGAGTTCCTCTGAATGTAGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138812.2-336s21c1
Sequence:CCGGGGAGCGTGAAAGAGAATTAGCCTCGAGGCTAATTCTCTTTCACGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138812.2-266s21c1
Sequence:CCGGCATTGTGGATTTACAAGTATACTCGAGTATACTTGTAAATCCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138812.2-643s21c1
Sequence:CCGGGAACTTGATGAACCAATGTTTCTCGAGAAACATTGGTTCATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027094
DYDC1 MISSION shRNA Bacterial Glycerol Stock
DPY30 domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-637s21c1
Sequence:CCGGTGAGCCAATGTTATCTGATAACTCGAGTTATCAGATAACATTGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-554s21c1
Sequence:CCGGTTGGTGATGGACTCGGGTAAACTCGAGTTTACCCGAGTCCATCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027094.1-681s21c1
Sequence:CCGGTCGTGGCGGCAGCACAAATATCTCGAGATATTTGTGCTGCCGCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-228s21c1
Sequence:CCGGCATTGGATCCAATTGAATATTCTCGAGAATATTCAATTGGATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-372s21c1
Sequence:CCGGTCAAAGCAGAAGAACTCTTATCTCGAGATAAGAGTTCTTCTGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027094
DYDC1 MISSION shRNA shRNA Plasmid DNA
DPY30 domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-637s21c1
Sequence:CCGGTGAGCCAATGTTATCTGATAACTCGAGTTATCAGATAACATTGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-554s21c1
Sequence:CCGGTTGGTGATGGACTCGGGTAAACTCGAGTTTACCCGAGTCCATCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027094.1-681s21c1
Sequence:CCGGTCGTGGCGGCAGCACAAATATCTCGAGATATTTGTGCTGCCGCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-228s21c1
Sequence:CCGGCATTGGATCCAATTGAATATTCTCGAGAATATTCAATTGGATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-372s21c1
Sequence:CCGGTCAAAGCAGAAGAACTCTTATCTCGAGATAAGAGTTCTTCTGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027094
DYDC1 MISSION shRNA Lentiviral Transduction Particles
DPY30 domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-637s21c1
Sequence:CCGGTGAGCCAATGTTATCTGATAACTCGAGTTATCAGATAACATTGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-554s21c1
Sequence:CCGGTTGGTGATGGACTCGGGTAAACTCGAGTTTACCCGAGTCCATCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027094.1-681s21c1
Sequence:CCGGTCGTGGCGGCAGCACAAATATCTCGAGATATTTGTGCTGCCGCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-228s21c1
Sequence:CCGGCATTGGATCCAATTGAATATTCTCGAGAATATTCAATTGGATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027094.1-372s21c1
Sequence:CCGGTCAAAGCAGAAGAACTCTTATCTCGAGATAAGAGTTCTTCTGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks