EMAIL THIS PAGE TO A FRIEND

DYDC2

DPY30 domain containing 2

78 Gene Product Result for
UniProtKB ID: Q96IM9, D3DWD6, Q5QP07, Q5QP11
Gene ID:
Human(84332) Summary: This gene encodes a member of a family of proteins that contains a DPY30 domain. This gene locus overlaps with a closely related gene on the opposite strand. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(71200) DPY30 domain containing 2
Rat(688422) DPY30 domain containing 2
domestic guinea pig(100726822) DPY30 domain containing 2
naked mole-rat(101714381) DPY30 domain containing 2
sheep(101108281) DPY30 domain containing 2
domestic cat(101080577) DPY30 domain containing 2
dog(610554) DPY30 domain containing 2
cow(514060) DPY30 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032372 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032372 Rosetta Predictions human pricing
NM_001134797 Rosetta Predictions rat pricing
NM_027717 Rosetta Predictions mouse pricing
XM_127662 Rosetta Predictions mouse pricing
XM_891397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140207 predicted 368
2 SASI_Hs01_00140208 predicted 281
3 SASI_Hs01_00140209 predicted 258
4 SASI_Hs01_00140210 predicted 454
5 SASI_Hs01_00140211 predicted 468
6 SASI_Hs01_00140212 predicted 402
7 SASI_Hs01_00140214 predicted 607
8 SASI_Hs01_00140215 predicted 615
9 SASI_Hs01_00140216 predicted 542
10 SASI_Hs02_00359757 predicted 731
11 SASI_Hs01_00140213 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258554 predicted 410
2 SASI_Rn02_00258555 predicted 421
3 SASI_Rn02_00258556 predicted 278
4 SASI_Rn02_00258557 predicted 337
5 SASI_Rn02_00258558 predicted 362
6 SASI_Rn02_00258559 predicted 453
7 SASI_Rn02_00258560 predicted 425
8 SASI_Rn02_00258561 predicted 386
9 SASI_Rn02_00258562 predicted 329
10 SASI_Rn02_00258563 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332640 predicted 342
2 SASI_Mm02_00332641 predicted 347
3 SASI_Mm02_00332642 predicted 301
4 SASI_Mm02_00332643 predicted 233
5 SASI_Mm02_00332644 predicted 197
6 SASI_Mm02_00332645 predicted 295
7 SASI_Mm02_00332646 predicted 226
8 SASI_Mm02_00332647 predicted 303
9 SASI_Mm02_00332648 predicted 291
10 SASI_Mm02_00332649 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251989 predicted 428
2 SASI_Mm01_00251990 predicted 481
3 SASI_Mm01_00251991 predicted 487
4 SASI_Mm01_00251992 predicted 449
5 SASI_Mm01_00251993 predicted 453
6 SASI_Mm01_00251994 predicted 430
7 SASI_Mm01_00251995 predicted 443
8 SASI_Mm01_00251996 predicted 448
9 SASI_Mm01_00251997 predicted 483
10 SASI_Mm01_00251998 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274028 predicted 246
2 SASI_Mm01_00274029 predicted 310
3 SASI_Mm01_00274030 predicted 309
4 SASI_Mm01_00274031 predicted 271
5 SASI_Mm01_00274032 predicted 271
6 SASI_Mm01_00274033 predicted 250
7 SASI_Mm01_00274034 predicted 264
8 SASI_Mm01_00274035 predicted 270
9 SASI_Mm01_00274036 predicted 305
10 SASI_Mm01_00274037 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027717
DYDC2 MISSION shRNA Bacterial Glycerol Stock
DPY30 domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-413s21c1
Sequence:CCGGCCTTGAGGAGAAGACTATGAGCTCGAGCTCATAGTCTTCTCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-299s21c1
Sequence:CCGGGCTGAAAGAAGAAGGCTATCACTCGAGTGATAGCCTTCTTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-234s21c1
Sequence:CCGGCAAGAGGAGCTACAGCTTAAGCTCGAGCTTAAGCTGTAGCTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-155s21c1
Sequence:CCGGGCCCAGTGACCCAATAGAGTACTCGAGTACTCTATTGGGTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-181s21c1
Sequence:CCGGCTCACTGGCTTTACCATTATACTCGAGTATAATGGTAAAGCCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027717
DYDC2 MISSION shRNA shRNA Plasmid DNA
DPY30 domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-413s21c1
Sequence:CCGGCCTTGAGGAGAAGACTATGAGCTCGAGCTCATAGTCTTCTCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-299s21c1
Sequence:CCGGGCTGAAAGAAGAAGGCTATCACTCGAGTGATAGCCTTCTTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-234s21c1
Sequence:CCGGCAAGAGGAGCTACAGCTTAAGCTCGAGCTTAAGCTGTAGCTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-155s21c1
Sequence:CCGGGCCCAGTGACCCAATAGAGTACTCGAGTACTCTATTGGGTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-181s21c1
Sequence:CCGGCTCACTGGCTTTACCATTATACTCGAGTATAATGGTAAAGCCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027717
DYDC2 MISSION shRNA Lentiviral Transduction Particles
DPY30 domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-413s21c1
Sequence:CCGGCCTTGAGGAGAAGACTATGAGCTCGAGCTCATAGTCTTCTCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-299s21c1
Sequence:CCGGGCTGAAAGAAGAAGGCTATCACTCGAGTGATAGCCTTCTTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-234s21c1
Sequence:CCGGCAAGAGGAGCTACAGCTTAAGCTCGAGCTTAAGCTGTAGCTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-155s21c1
Sequence:CCGGGCCCAGTGACCCAATAGAGTACTCGAGTACTCTATTGGGTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027717.1-181s21c1
Sequence:CCGGCTCACTGGCTTTACCATTATACTCGAGTATAATGGTAAAGCCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032372
DYDC2 MISSION shRNA Bacterial Glycerol Stock
DPY30 domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032372.2-631s1c1
Sequence:CCGGCACAAGGAACTGACTTCTGAACTCGAGTTCAGAAGTCAGTTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032372.2-552s1c1
Sequence:CCGGCAGTAGCCTCAAGGAAATGGACTCGAGTCCATTTCCTTGAGGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-671s1c1
Sequence:CCGGCCATATTCATGCAGGAGGACACTCGAGTGTCCTCCTGCATGAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-750s1c1
Sequence:CCGGGATTCCAGGAATGCCTCAACACTCGAGTGTTGAGGCATTCCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-452s1c1
Sequence:CCGGCAATAGAATACCTGGCTCACTCTCGAGAGTGAGCCAGGTATTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-592s1c1
Sequence:CCGGCAGGAAGAGTATCAGATTCAACTCGAGTTGAATCTGATACTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-604s1c1
Sequence:CCGGCAGATTCAACAGAACTGTGAACTCGAGTTCACAGTTCTGTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032372.2-796s1c1
Sequence:CCGGCAGATTGACCAGAACTTCAAACTCGAGTTTGAAGTTCTGGTCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032372.2-588s1c1
Sequence:CCGGGAAACAGGAAGAGTATCAGATCTCGAGATCTGATACTCTTCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032372
DYDC2 MISSION shRNA shRNA Plasmid DNA
DPY30 domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032372.2-631s1c1
Sequence:CCGGCACAAGGAACTGACTTCTGAACTCGAGTTCAGAAGTCAGTTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032372.2-552s1c1
Sequence:CCGGCAGTAGCCTCAAGGAAATGGACTCGAGTCCATTTCCTTGAGGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-671s1c1
Sequence:CCGGCCATATTCATGCAGGAGGACACTCGAGTGTCCTCCTGCATGAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-750s1c1
Sequence:CCGGGATTCCAGGAATGCCTCAACACTCGAGTGTTGAGGCATTCCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-452s1c1
Sequence:CCGGCAATAGAATACCTGGCTCACTCTCGAGAGTGAGCCAGGTATTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-592s1c1
Sequence:CCGGCAGGAAGAGTATCAGATTCAACTCGAGTTGAATCTGATACTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-604s1c1
Sequence:CCGGCAGATTCAACAGAACTGTGAACTCGAGTTCACAGTTCTGTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032372.2-796s1c1
Sequence:CCGGCAGATTGACCAGAACTTCAAACTCGAGTTTGAAGTTCTGGTCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032372.2-588s1c1
Sequence:CCGGGAAACAGGAAGAGTATCAGATCTCGAGATCTGATACTCTTCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032372
DYDC2 MISSION shRNA Lentiviral Transduction Particles
DPY30 domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032372.2-631s1c1
Sequence:CCGGCACAAGGAACTGACTTCTGAACTCGAGTTCAGAAGTCAGTTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032372.2-552s1c1
Sequence:CCGGCAGTAGCCTCAAGGAAATGGACTCGAGTCCATTTCCTTGAGGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-671s1c1
Sequence:CCGGCCATATTCATGCAGGAGGACACTCGAGTGTCCTCCTGCATGAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-750s1c1
Sequence:CCGGGATTCCAGGAATGCCTCAACACTCGAGTGTTGAGGCATTCCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-452s1c1
Sequence:CCGGCAATAGAATACCTGGCTCACTCTCGAGAGTGAGCCAGGTATTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-592s1c1
Sequence:CCGGCAGGAAGAGTATCAGATTCAACTCGAGTTGAATCTGATACTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032372.2-604s1c1
Sequence:CCGGCAGATTCAACAGAACTGTGAACTCGAGTTCACAGTTCTGTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032372.2-796s1c1
Sequence:CCGGCAGATTGACCAGAACTTCAAACTCGAGTTTGAAGTTCTGGTCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032372.2-588s1c1
Sequence:CCGGGAAACAGGAAGAGTATCAGATCTCGAGATCTGATACTCTTCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks