EMAIL THIS PAGE TO A FRIEND

DYM

dymeclin

67 Gene Product Result for
Synonyms: DMC SMC
Gene ID:
Human(54808) Summary: This gene encodes a protein which is necessary for normal skeletal development and brain function. Mutations in this gene are associated with two types of recessive osteochondrodysplasia, Dyggve-Melchior-Clausen (DMC) dysplasia and Smith-McCort (SMC) dysplasia, which involve both skeletal defects and mental retardation. [provided by RefSeq, Jul 2008]
Mouse(69190) dymeclin
Rat(291433) dymeclin
cow(613923) dymeclin
Horse(100053667) dymeclin
dog(480222) dymeclin
chicken(426843) dymeclin
sheep(101115171) dymeclin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017653 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017653 Rosetta Predictions human pricing
NM_001106133 Rosetta Predictions rat pricing
NM_027727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350357 predicted 1367
2 SASI_Hs01_00238635 predicted 1913
3 SASI_Hs01_00238636 predicted 501
4 SASI_Hs01_00238637 predicted 573
5 SASI_Hs01_00238638 predicted 841
6 SASI_Hs01_00238639 predicted 593
7 SASI_Hs01_00238640 predicted 820
8 SASI_Hs01_00238641 predicted 1599
9 SASI_Hs01_00238642 predicted 2046
10 SASI_Hs01_00238644 predicted 772
11 SASI_Hs01_00238643 predicted 1899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215948 predicted 1496
2 SASI_Rn02_00215949 predicted 1384
3 SASI_Rn02_00215950 predicted 1568
4 SASI_Rn02_00215951 predicted 705
5 SASI_Rn02_00215952 predicted 2113
6 SASI_Rn02_00215953 predicted 1628
7 SASI_Rn02_00215954 predicted 1914
8 SASI_Rn02_00215955 predicted 2009
9 SASI_Rn02_00215956 predicted 1421
10 SASI_Rn02_00215957 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332655 predicted 1944
2 SASI_Mm01_00154609 predicted 490
3 SASI_Mm01_00154610 predicted 1435
4 SASI_Mm01_00154611 predicted 1578
5 SASI_Mm01_00154612 predicted 1423
6 SASI_Mm01_00154613 predicted 2114
7 SASI_Mm01_00154614 predicted 430
8 SASI_Mm01_00154615 predicted 1445
9 SASI_Mm01_00154617 predicted 1227
10 SASI_Mm01_00154618 predicted 473
11 SASI_Mm01_00154616 predicted 1545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017653
VALIDATED
DYM MISSION shRNA Bacterial Glycerol Stock
dymeclin
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017653.2-1541s1c1
Sequence:CCGGCCATGTGTATATGGCCCTTATCTCGAGATAAGGGCCATATACACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017653.2-2455s1c1
Sequence:CCGGCAGACAGGTTACTTGGTGTATCTCGAGATACACCAAGTAACCTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017653.2-668s1c1
Sequence:CCGGGCAGACACACAATGCTTTGTTCTCGAGAACAAAGCATTGTGTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017653.2-1921s1c1
Sequence:CCGGCAGATTATGCACAAGACCTAACTCGAGTTAGGTCTTGTGCATAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017653.2-591s1c1
Sequence:CCGGGCACTAATTAAGGTCTTCCTTCTCGAGAAGGAAGACCTTAATTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017653.2-1542s1c1
Sequence:CCGGCATGTGTATATGGCCCTTATACTCGAGTATAAGGGCCATATACACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017653.2-2445s1c1
Sequence:CCGGCAGAAGTAGACAGACAGGTTACTCGAGTAACCTGTCTGTCTACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-2168s21c1
Sequence:CCGGACGGGTCCTGGAAATCATTAACTCGAGTTAATGATTTCCAGGACCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-1753s21c1
Sequence:CCGGGTTTGGCAGCTTTAGCAAATACTCGAGTATTTGCTAAAGCTGCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-2045s21c1
Sequence:CCGGACGCGATCTCTTTGAACAATTCTCGAGAATTGTTCAAAGAGATCGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-1887s21c1
Sequence:CCGGAGAGGTTCGCTGAGTTCTAATCTCGAGATTAGAACTCAGCGAACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-462s21c1
Sequence:CCGGTGGAATCAGCTTCTCTCATTTCTCGAGAAATGAGAGAAGCTGATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017653.3-2458s21c1
Sequence:CCGGACAGGTTACTTGGTGTATCTTCTCGAGAAGATACACCAAGTAACCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017653.3-2486s21c1
Sequence:CCGGAGAGGATTGCACGAGTGTGTTCTCGAGAACACACTCGTGCAATCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-848s21c1
Sequence:CCGGTATTCCACTCTTAGATATTACCTCGAGGTAATATCTAAGAGTGGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017653
VALIDATED
DYM MISSION shRNA shRNA Plasmid DNA
dymeclin
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017653.2-1541s1c1
Sequence:CCGGCCATGTGTATATGGCCCTTATCTCGAGATAAGGGCCATATACACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017653.2-2455s1c1
Sequence:CCGGCAGACAGGTTACTTGGTGTATCTCGAGATACACCAAGTAACCTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017653.2-668s1c1
Sequence:CCGGGCAGACACACAATGCTTTGTTCTCGAGAACAAAGCATTGTGTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017653.2-1921s1c1
Sequence:CCGGCAGATTATGCACAAGACCTAACTCGAGTTAGGTCTTGTGCATAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017653.2-591s1c1
Sequence:CCGGGCACTAATTAAGGTCTTCCTTCTCGAGAAGGAAGACCTTAATTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017653.2-1542s1c1
Sequence:CCGGCATGTGTATATGGCCCTTATACTCGAGTATAAGGGCCATATACACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017653.2-2445s1c1
Sequence:CCGGCAGAAGTAGACAGACAGGTTACTCGAGTAACCTGTCTGTCTACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-2168s21c1
Sequence:CCGGACGGGTCCTGGAAATCATTAACTCGAGTTAATGATTTCCAGGACCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-1753s21c1
Sequence:CCGGGTTTGGCAGCTTTAGCAAATACTCGAGTATTTGCTAAAGCTGCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-2045s21c1
Sequence:CCGGACGCGATCTCTTTGAACAATTCTCGAGAATTGTTCAAAGAGATCGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-1887s21c1
Sequence:CCGGAGAGGTTCGCTGAGTTCTAATCTCGAGATTAGAACTCAGCGAACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-462s21c1
Sequence:CCGGTGGAATCAGCTTCTCTCATTTCTCGAGAAATGAGAGAAGCTGATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017653.3-2458s21c1
Sequence:CCGGACAGGTTACTTGGTGTATCTTCTCGAGAAGATACACCAAGTAACCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017653.3-2486s21c1
Sequence:CCGGAGAGGATTGCACGAGTGTGTTCTCGAGAACACACTCGTGCAATCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-848s21c1
Sequence:CCGGTATTCCACTCTTAGATATTACCTCGAGGTAATATCTAAGAGTGGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017653
VALIDATED
DYM MISSION shRNA Lentiviral Transduction Particles
dymeclin
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017653.2-1541s1c1
Sequence:CCGGCCATGTGTATATGGCCCTTATCTCGAGATAAGGGCCATATACACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017653.2-2455s1c1
Sequence:CCGGCAGACAGGTTACTTGGTGTATCTCGAGATACACCAAGTAACCTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017653.2-668s1c1
Sequence:CCGGGCAGACACACAATGCTTTGTTCTCGAGAACAAAGCATTGTGTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017653.2-1921s1c1
Sequence:CCGGCAGATTATGCACAAGACCTAACTCGAGTTAGGTCTTGTGCATAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017653.2-591s1c1
Sequence:CCGGGCACTAATTAAGGTCTTCCTTCTCGAGAAGGAAGACCTTAATTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017653.2-1542s1c1
Sequence:CCGGCATGTGTATATGGCCCTTATACTCGAGTATAAGGGCCATATACACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017653.2-2445s1c1
Sequence:CCGGCAGAAGTAGACAGACAGGTTACTCGAGTAACCTGTCTGTCTACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-2168s21c1
Sequence:CCGGACGGGTCCTGGAAATCATTAACTCGAGTTAATGATTTCCAGGACCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-1753s21c1
Sequence:CCGGGTTTGGCAGCTTTAGCAAATACTCGAGTATTTGCTAAAGCTGCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-2045s21c1
Sequence:CCGGACGCGATCTCTTTGAACAATTCTCGAGAATTGTTCAAAGAGATCGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-1887s21c1
Sequence:CCGGAGAGGTTCGCTGAGTTCTAATCTCGAGATTAGAACTCAGCGAACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-462s21c1
Sequence:CCGGTGGAATCAGCTTCTCTCATTTCTCGAGAAATGAGAGAAGCTGATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017653.3-2458s21c1
Sequence:CCGGACAGGTTACTTGGTGTATCTTCTCGAGAAGATACACCAAGTAACCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017653.3-2486s21c1
Sequence:CCGGAGAGGATTGCACGAGTGTGTTCTCGAGAACACACTCGTGCAATCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017653.3-848s21c1
Sequence:CCGGTATTCCACTCTTAGATATTACCTCGAGGTAATATCTAAGAGTGGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027727
VALIDATED
DYM MISSION shRNA Bacterial Glycerol Stock
dymeclin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027727.1-1926s1c1
Sequence:CCGGGTGTACGCCTTGCTTTACAAACTCGAGTTTGTAAAGCAAGGCGTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027727.1-569s1c1
Sequence:CCGGGCAGACACACAATGCTCTGTTCTCGAGAACAGAGCATTGTGTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027727.1-1576s1c1
Sequence:CCGGGCCTCCTAATTCTGGTGGTAACTCGAGTTACCACCAGAATTAGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027727.1-1937s1c1
Sequence:CCGGGCTTTACAAACGGGACCTCTTCTCGAGAAGAGGTCCCGTTTGTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-854s1c1
Sequence:CCGGCATCAGTCACAAGTACCTGATCTCGAGATCAGGTACTTGTGACTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-436s1c1
Sequence:CCGGCCATTTCAGTTTGCAAGTCTTCTCGAGAAGACTTGCAAACTGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-1841s1c2
Sequence:CCGGCAGTGTCATTGAAGAAGTGATCTCGAGATCACTTCTTCAATGACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-437s1c1
Sequence:CCGGCATTTCAGTTTGCAAGTCTTTCTCGAGAAAGACTTGCAAACTGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.2-1442s1c1
Sequence:CCGGATGTCTATATGGCCCTTATAACTCGAGTTATAAGGGCCATATAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027727
VALIDATED
DYM MISSION shRNA shRNA Plasmid DNA
dymeclin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027727.1-1926s1c1
Sequence:CCGGGTGTACGCCTTGCTTTACAAACTCGAGTTTGTAAAGCAAGGCGTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027727.1-569s1c1
Sequence:CCGGGCAGACACACAATGCTCTGTTCTCGAGAACAGAGCATTGTGTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027727.1-1576s1c1
Sequence:CCGGGCCTCCTAATTCTGGTGGTAACTCGAGTTACCACCAGAATTAGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027727.1-1937s1c1
Sequence:CCGGGCTTTACAAACGGGACCTCTTCTCGAGAAGAGGTCCCGTTTGTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-854s1c1
Sequence:CCGGCATCAGTCACAAGTACCTGATCTCGAGATCAGGTACTTGTGACTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-436s1c1
Sequence:CCGGCCATTTCAGTTTGCAAGTCTTCTCGAGAAGACTTGCAAACTGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-1841s1c2
Sequence:CCGGCAGTGTCATTGAAGAAGTGATCTCGAGATCACTTCTTCAATGACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-437s1c1
Sequence:CCGGCATTTCAGTTTGCAAGTCTTTCTCGAGAAAGACTTGCAAACTGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.2-1442s1c1
Sequence:CCGGATGTCTATATGGCCCTTATAACTCGAGTTATAAGGGCCATATAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027727
VALIDATED
DYM MISSION shRNA Lentiviral Transduction Particles
dymeclin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027727.1-1926s1c1
Sequence:CCGGGTGTACGCCTTGCTTTACAAACTCGAGTTTGTAAAGCAAGGCGTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027727.1-569s1c1
Sequence:CCGGGCAGACACACAATGCTCTGTTCTCGAGAACAGAGCATTGTGTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027727.1-1576s1c1
Sequence:CCGGGCCTCCTAATTCTGGTGGTAACTCGAGTTACCACCAGAATTAGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027727.1-1937s1c1
Sequence:CCGGGCTTTACAAACGGGACCTCTTCTCGAGAAGAGGTCCCGTTTGTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-854s1c1
Sequence:CCGGCATCAGTCACAAGTACCTGATCTCGAGATCAGGTACTTGTGACTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-436s1c1
Sequence:CCGGCCATTTCAGTTTGCAAGTCTTCTCGAGAAGACTTGCAAACTGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-1841s1c2
Sequence:CCGGCAGTGTCATTGAAGAAGTGATCTCGAGATCACTTCTTCAATGACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.1-437s1c1
Sequence:CCGGCATTTCAGTTTGCAAGTCTTTCTCGAGAAAGACTTGCAAACTGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027727.2-1442s1c1
Sequence:CCGGATGTCTATATGGCCCTTATAACTCGAGTTATAAGGGCCATATAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)