EMAIL THIS PAGE TO A FRIEND

DYNAP

dynactin associated protein

60 Gene Product Result for
Synonyms: C18orf26
UniProtKB ID: Q8N1N2
Gene ID:
Mouse(75577) dynactin associated protein
Rat(680077) dynactin associated protein
naked mole-rat(101710269) dynactin associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173629 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173629 Rosetta Predictions human pricing
XM_001055577 Rosetta Predictions rat pricing
XM_128949 Rosetta Predictions mouse pricing
XM_915395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093594 predicted 551
2 SASI_Hs01_00093595 predicted 658
3 SASI_Hs01_00093597 predicted 753
4 SASI_Hs01_00093598 predicted 393
5 SASI_Hs02_00368506 predicted 719
6 SASI_Hs01_00093599 predicted 460
7 SASI_Hs01_00093600 predicted 418
8 SASI_Hs02_00368507 predicted 771
9 SASI_Hs01_00093602 predicted 371
10 SASI_Hs02_00368508 predicted 477
11 SASI_Hs01_00093596 predicted 735
12 SASI_Hs01_00093601 predicted 695
13 SASI_Hs01_00093603 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280142 predicted 384
2 SASI_Rn02_00280143 predicted 373
3 SASI_Rn02_00280144 predicted 399
4 SASI_Rn02_00280145 predicted 309
5 SASI_Rn02_00280146 predicted 425
6 SASI_Rn02_00280147 predicted 295
7 SASI_Rn02_00280148 predicted 396
8 SASI_Rn02_00280149 predicted 489
9 SASI_Rn02_00280150 predicted 486
10 SASI_Rn02_00280151 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251586 predicted 392
2 SASI_Mm01_00251587 predicted 404
3 SASI_Mm01_00251588 predicted 919
4 SASI_Mm01_00251589 predicted 785
5 SASI_Mm01_00251590 predicted 747
6 SASI_Mm01_00251591 predicted 800
7 SASI_Mm01_00251592 predicted 887
8 SASI_Mm01_00251593 predicted 364
9 SASI_Mm01_00251594 predicted 409
10 SASI_Mm02_00424288 predicted 633
11 SASI_Mm01_00251595 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439407 predicted 393
2 SASI_Mm02_00439408 predicted 403
3 SASI_Mm02_00439409 predicted 918
4 SASI_Mm02_00439410 predicted 778
5 SASI_Mm02_00439411 predicted 749
6 SASI_Mm02_00439412 predicted 805
7 SASI_Mm02_00439413 predicted 889
8 SASI_Mm02_00439414 predicted 363
9 SASI_Mm02_00439415 predicted 401
10 SASI_Mm02_00439416 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173629
DYNAP MISSION shRNA Bacterial Glycerol Stock
dynactin associated protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173629.1-123s1c1
Sequence:CCGGGAATGGACAGAAAGCATGGAACTCGAGTTCCATGCTTTCTGTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173629.1-1807s1c1
Sequence:CCGGGCAACTACAAATGCCACCATTCTCGAGAATGGTGGCATTTGTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173629.1-884s1c1
Sequence:CCGGCGACCATCTCTTTGACTGAATCTCGAGATTCAGTCAAAGAGATGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173629.1-594s1c1
Sequence:CCGGCAGCCACTGAATCTACAACTTCTCGAGAAGTTGTAGATTCAGTGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-597s1c1
Sequence:CCGGCCACTGAATCTACAACTTCAACTCGAGTTGAAGTTGTAGATTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-447s1c1
Sequence:CCGGGCTTGGTGAATAACAAAGGATCTCGAGATCCTTTGTTATTCACCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173629.1-480s1c1
Sequence:CCGGCCATTGTTATCCAGCTATCCACTCGAGTGGATAGCTGGATAACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-255s1c1
Sequence:CCGGGTGATGTCTCTCCCAACTTAACTCGAGTTAAGTTGGGAGAGACATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173629.1-978s1c1
Sequence:CCGGGCCTACAGTAACAATGCTCATCTCGAGATGAGCATTGTTACTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173629.1-1583s1c1
Sequence:CCGGGCCTTTCTGAACCAAGCCAATCTCGAGATTGGCTTGGTTCAGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-468s1c1
Sequence:CCGGCGGCCAATTCCTCCATTGTTACTCGAGTAACAATGGAGGAATTGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173629
DYNAP MISSION shRNA shRNA Plasmid DNA
dynactin associated protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173629.1-123s1c1
Sequence:CCGGGAATGGACAGAAAGCATGGAACTCGAGTTCCATGCTTTCTGTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173629.1-1807s1c1
Sequence:CCGGGCAACTACAAATGCCACCATTCTCGAGAATGGTGGCATTTGTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173629.1-884s1c1
Sequence:CCGGCGACCATCTCTTTGACTGAATCTCGAGATTCAGTCAAAGAGATGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173629.1-594s1c1
Sequence:CCGGCAGCCACTGAATCTACAACTTCTCGAGAAGTTGTAGATTCAGTGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-597s1c1
Sequence:CCGGCCACTGAATCTACAACTTCAACTCGAGTTGAAGTTGTAGATTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-447s1c1
Sequence:CCGGGCTTGGTGAATAACAAAGGATCTCGAGATCCTTTGTTATTCACCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173629.1-480s1c1
Sequence:CCGGCCATTGTTATCCAGCTATCCACTCGAGTGGATAGCTGGATAACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-255s1c1
Sequence:CCGGGTGATGTCTCTCCCAACTTAACTCGAGTTAAGTTGGGAGAGACATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173629.1-978s1c1
Sequence:CCGGGCCTACAGTAACAATGCTCATCTCGAGATGAGCATTGTTACTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173629.1-1583s1c1
Sequence:CCGGGCCTTTCTGAACCAAGCCAATCTCGAGATTGGCTTGGTTCAGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-468s1c1
Sequence:CCGGCGGCCAATTCCTCCATTGTTACTCGAGTAACAATGGAGGAATTGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173629
DYNAP MISSION shRNA Lentiviral Transduction Particles
dynactin associated protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173629.1-123s1c1
Sequence:CCGGGAATGGACAGAAAGCATGGAACTCGAGTTCCATGCTTTCTGTCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173629.1-1807s1c1
Sequence:CCGGGCAACTACAAATGCCACCATTCTCGAGAATGGTGGCATTTGTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173629.1-884s1c1
Sequence:CCGGCGACCATCTCTTTGACTGAATCTCGAGATTCAGTCAAAGAGATGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173629.1-594s1c1
Sequence:CCGGCAGCCACTGAATCTACAACTTCTCGAGAAGTTGTAGATTCAGTGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-597s1c1
Sequence:CCGGCCACTGAATCTACAACTTCAACTCGAGTTGAAGTTGTAGATTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-447s1c1
Sequence:CCGGGCTTGGTGAATAACAAAGGATCTCGAGATCCTTTGTTATTCACCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173629.1-480s1c1
Sequence:CCGGCCATTGTTATCCAGCTATCCACTCGAGTGGATAGCTGGATAACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-255s1c1
Sequence:CCGGGTGATGTCTCTCCCAACTTAACTCGAGTTAAGTTGGGAGAGACATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173629.1-978s1c1
Sequence:CCGGGCCTACAGTAACAATGCTCATCTCGAGATGAGCATTGTTACTGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173629.1-1583s1c1
Sequence:CCGGGCCTTTCTGAACCAAGCCAATCTCGAGATTGGCTTGGTTCAGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173629.1-468s1c1
Sequence:CCGGCGGCCAATTCCTCCATTGTTACTCGAGTAACAATGGAGGAATTGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)