EMAIL THIS PAGE TO A FRIEND

DYNC1H1

dynein, cytoplasmic 1, heavy chain 1

67 Gene Product Result for
Synonyms: DHC1 DHC1a DNCH1 DNCL DNECL DYHC Dnchc1 HL-3 SMALED1 p22
UniProtKB ID: Q14204, B0I1R0, Q6DKQ7, Q8WU28, Q92814, Q9Y4G5
Gene ID:
Human(1778) Summary: Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
Mouse(13424) dynein cytoplasmic 1 heavy chain 1
Rat(29489) dynein cytoplasmic 1 heavy chain 1
sheep(101102427) dynein, cytoplasmic 1, heavy chain 1
naked mole-rat(101725715) dynein, cytoplasmic 1, heavy chain 1
domestic guinea pig(100733085) dynein, cytoplasmic 1, heavy chain 1
Zebrafish(335110) dynein, cytoplasmic 1, heavy chain 1
chicken(423461) dynein, cytoplasmic 1, heavy chain 1
dog(480437) dynein, cytoplasmic 1, heavy chain 1
cow(537748) dynein, cytoplasmic 1, heavy chain 1
domestic cat(101082576) dynein, cytoplasmic 1, heavy chain 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0281 AQUA Peptide DLFQVAFN[R] cow, dog, human, mouse, rat pricing
AQ0280 AQUA Peptide VQGLTVEQAEAVA[R] rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001376 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001376 Rosetta Predictions human pricing
NM_019226 Rosetta Predictions rat pricing
XM_579426 Rosetta Predictions rat pricing
NM_030238 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028998 predicted 4462
2 SASI_Hs01_00028999 predicted 8523
3 SASI_Hs01_00029001 predicted 10676
4 SASI_Hs02_00331725 predicted 11554
5 SASI_Hs01_00029003 predicted 7637
6 SASI_Hs02_00331726 predicted 11118
7 SASI_Hs02_00331727 predicted 13392
8 SASI_Hs01_00029005 predicted 8916
9 SASI_Hs02_00331728 predicted 12880
10 SASI_Hs01_00029007 predicted 10858
11 SASI_Hs01_00029000 predicted 856
12 SASI_Hs01_00029002 predicted 10238
13 SASI_Hs01_00029004 predicted 10695
14 SASI_Hs01_00029006 predicted 9417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038040 predicted 8588
2 SASI_Rn01_00038041 predicted 402
3 SASI_Rn01_00038043 predicted 10307
4 SASI_Rn01_00038044 predicted 2462
5 SASI_Rn01_00038045 predicted 10842
6 SASI_Rn01_00038046 predicted 9476
7 SASI_Rn01_00038047 predicted 1308
8 SASI_Rn02_00262085 predicted 4523
9 SASI_Rn02_00262086 predicted 10740
10 SASI_Rn01_00038049 predicted 2448
11 SASI_Rn01_00038042 predicted 4282
12 SASI_Rn01_00038048 predicted 5186
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173691 predicted 8656
2 SASI_Rn01_00173692 predicted 3742
3 SASI_Rn01_00173693 predicted 10385
4 SASI_Rn01_00173694 predicted 10365
5 SASI_Rn01_00173695 predicted 4885
6 SASI_Rn01_00173696 predicted 9546
7 SASI_Rn01_00173697 predicted 5110
8 SASI_Rn01_00173698 predicted 9324
9 SASI_Rn01_00173699 predicted 4433
10 SASI_Rn01_00173700 predicted 4033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336699 predicted 4907
2 SASI_Mm01_00117701 predicted 9501
3 SASI_Mm01_00117704 predicted 4455
4 SASI_Mm01_00117705 predicted 10396
5 SASI_Mm01_00117706 predicted 8678
6 SASI_Mm01_00117707 predicted 9564
7 SASI_Mm01_00117708 predicted 5463
8 SASI_Mm01_00117709 predicted 5652
9 SASI_Mm01_00117710 predicted 2554
10 SASI_Mm02_00336700 predicted 11420
11 SASI_Mm01_00117702 predicted 10345
12 SASI_Mm01_00117703 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001376
VALIDATED
DYNC1H1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 1, heavy chain 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001376.2-5110s1c1
Sequence:CCGGCCTGTGTCAATTACTGAACATCTCGAGATGTTCAGTAATTGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001376.2-11703s1c1
Sequence:CCGGGCTGGCAAGAATCAAACTGAACTCGAGTTCAGTTTGATTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001376.2-14002s1c1
Sequence:CCGGCCTTTCTGTAATAGTGAAAGTCTCGAGACTTTCACTATTACAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001376.2-412s1c1
Sequence:CCGGCCCGTGATTGATGCAGATAAACTCGAGTTTATCTGCATCAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001376.2-9748s1c1
Sequence:CCGGGCAGCCAATGACAAGCTGAAACTCGAGTTTCAGCTTGTCATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001376.4-11822s21c1
Sequence:CCGGGCTGGCAAGAATCAAACTGAACTCGAGTTCAGTTTGATTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001376.4-531s21c1
Sequence:CCGGCCCGTGATTGATGCAGATAAACTCGAGTTTATCTGCATCAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001376.4-14173s21c1
Sequence:CCGGTTTGGAAGGTCTGAGCTTGTGCTCGAGCACAAGCTCAGACCTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001376.4-911s21c1
Sequence:CCGGTAACCGCTGGATCCGAGAAATCTCGAGATTTCTCGGATCCAGCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001376.4-9867s21c1
Sequence:CCGGGCAGCCAATGACAAGCTGAAACTCGAGTTTCAGCTTGTCATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001376
VALIDATED
DYNC1H1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 1, heavy chain 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001376.2-5110s1c1
Sequence:CCGGCCTGTGTCAATTACTGAACATCTCGAGATGTTCAGTAATTGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001376.2-11703s1c1
Sequence:CCGGGCTGGCAAGAATCAAACTGAACTCGAGTTCAGTTTGATTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001376.2-14002s1c1
Sequence:CCGGCCTTTCTGTAATAGTGAAAGTCTCGAGACTTTCACTATTACAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001376.2-412s1c1
Sequence:CCGGCCCGTGATTGATGCAGATAAACTCGAGTTTATCTGCATCAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001376.2-9748s1c1
Sequence:CCGGGCAGCCAATGACAAGCTGAAACTCGAGTTTCAGCTTGTCATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001376.4-11822s21c1
Sequence:CCGGGCTGGCAAGAATCAAACTGAACTCGAGTTCAGTTTGATTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001376.4-531s21c1
Sequence:CCGGCCCGTGATTGATGCAGATAAACTCGAGTTTATCTGCATCAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001376.4-14173s21c1
Sequence:CCGGTTTGGAAGGTCTGAGCTTGTGCTCGAGCACAAGCTCAGACCTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001376.4-911s21c1
Sequence:CCGGTAACCGCTGGATCCGAGAAATCTCGAGATTTCTCGGATCCAGCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001376.4-9867s21c1
Sequence:CCGGGCAGCCAATGACAAGCTGAAACTCGAGTTTCAGCTTGTCATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001376
VALIDATED
DYNC1H1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 1, heavy chain 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001376.2-5110s1c1
Sequence:CCGGCCTGTGTCAATTACTGAACATCTCGAGATGTTCAGTAATTGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001376.2-11703s1c1
Sequence:CCGGGCTGGCAAGAATCAAACTGAACTCGAGTTCAGTTTGATTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001376.2-14002s1c1
Sequence:CCGGCCTTTCTGTAATAGTGAAAGTCTCGAGACTTTCACTATTACAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001376.2-412s1c1
Sequence:CCGGCCCGTGATTGATGCAGATAAACTCGAGTTTATCTGCATCAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001376.2-9748s1c1
Sequence:CCGGGCAGCCAATGACAAGCTGAAACTCGAGTTTCAGCTTGTCATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001376.4-11822s21c1
Sequence:CCGGGCTGGCAAGAATCAAACTGAACTCGAGTTCAGTTTGATTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001376.4-531s21c1
Sequence:CCGGCCCGTGATTGATGCAGATAAACTCGAGTTTATCTGCATCAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001376.4-14173s21c1
Sequence:CCGGTTTGGAAGGTCTGAGCTTGTGCTCGAGCACAAGCTCAGACCTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001376.4-911s21c1
Sequence:CCGGTAACCGCTGGATCCGAGAAATCTCGAGATTTCTCGGATCCAGCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001376.4-9867s21c1
Sequence:CCGGGCAGCCAATGACAAGCTGAAACTCGAGTTTCAGCTTGTCATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030238
VALIDATED
DYNC1H1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 1, heavy chain 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-14177s1c1
Sequence:CCGGGAAGGGTTGATGGACTGGAAACTCGAGTTTCCAGTCCATCAACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-9459s1c1
Sequence:CCGGGCACTGTATCAAGTCGGCAAACTCGAGTTTGCCGACTTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-5146s1c1
Sequence:CCGGGCATCATCTTAAATGAGGATACTCGAGTATCCTCATTTAAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-8733s1c1
Sequence:CCGGCCTAACATAGACAAAGAGAAACTCGAGTTTCTCTTTGTCTATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-14020s1c1
Sequence:CCGGCCGTGGACTTTGAAATTGCTACTCGAGTAGCAATTTCAAAGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030238.2-14223s21c1
Sequence:CCGGGAAGGGTTGATGGACTGGAAACTCGAGTTTCCAGTCCATCAACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-14066s21c1
Sequence:CCGGCCGTGGACTTTGAAATTGCTACTCGAGTAGCAATTTCAAAGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-5192s21c1
Sequence:CCGGGCATCATCTTAAATGAGGATACTCGAGTATCCTCATTTAAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-8779s21c2
Sequence:CCGGCCTAACATAGACAAAGAGAAACTCGAGTTTCTCTTTGTCTATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-9505s21c1
Sequence:CCGGGCACTGTATCAAGTCGGCAAACTCGAGTTTGCCGACTTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030238
VALIDATED
DYNC1H1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 1, heavy chain 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-14177s1c1
Sequence:CCGGGAAGGGTTGATGGACTGGAAACTCGAGTTTCCAGTCCATCAACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-9459s1c1
Sequence:CCGGGCACTGTATCAAGTCGGCAAACTCGAGTTTGCCGACTTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-5146s1c1
Sequence:CCGGGCATCATCTTAAATGAGGATACTCGAGTATCCTCATTTAAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-8733s1c1
Sequence:CCGGCCTAACATAGACAAAGAGAAACTCGAGTTTCTCTTTGTCTATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-14020s1c1
Sequence:CCGGCCGTGGACTTTGAAATTGCTACTCGAGTAGCAATTTCAAAGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030238.2-14223s21c1
Sequence:CCGGGAAGGGTTGATGGACTGGAAACTCGAGTTTCCAGTCCATCAACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-14066s21c1
Sequence:CCGGCCGTGGACTTTGAAATTGCTACTCGAGTAGCAATTTCAAAGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-5192s21c1
Sequence:CCGGGCATCATCTTAAATGAGGATACTCGAGTATCCTCATTTAAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-8779s21c2
Sequence:CCGGCCTAACATAGACAAAGAGAAACTCGAGTTTCTCTTTGTCTATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-9505s21c1
Sequence:CCGGGCACTGTATCAAGTCGGCAAACTCGAGTTTGCCGACTTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030238
VALIDATED
DYNC1H1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 1, heavy chain 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-14177s1c1
Sequence:CCGGGAAGGGTTGATGGACTGGAAACTCGAGTTTCCAGTCCATCAACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-9459s1c1
Sequence:CCGGGCACTGTATCAAGTCGGCAAACTCGAGTTTGCCGACTTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-5146s1c1
Sequence:CCGGGCATCATCTTAAATGAGGATACTCGAGTATCCTCATTTAAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-8733s1c1
Sequence:CCGGCCTAACATAGACAAAGAGAAACTCGAGTTTCTCTTTGTCTATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030238.1-14020s1c1
Sequence:CCGGCCGTGGACTTTGAAATTGCTACTCGAGTAGCAATTTCAAAGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030238.2-14223s21c1
Sequence:CCGGGAAGGGTTGATGGACTGGAAACTCGAGTTTCCAGTCCATCAACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-14066s21c1
Sequence:CCGGCCGTGGACTTTGAAATTGCTACTCGAGTAGCAATTTCAAAGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-5192s21c1
Sequence:CCGGGCATCATCTTAAATGAGGATACTCGAGTATCCTCATTTAAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-8779s21c2
Sequence:CCGGCCTAACATAGACAAAGAGAAACTCGAGTTTCTCTTTGTCTATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030238.2-9505s21c1
Sequence:CCGGGCACTGTATCAAGTCGGCAAACTCGAGTTTGCCGACTTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks