EMAIL THIS PAGE TO A FRIEND

DYNC1I1

dynein, cytoplasmic 1, intermediate chain 1

113 Gene Product Result for
Synonyms: DNCI1 DNCIC1
UniProtKB ID: O14576, Q9Y2X1
Gene ID:
Mouse(13426) dynein cytoplasmic 1 intermediate chain 1
Rat(29564) dynein cytoplasmic 1 intermediate chain 1
Zebrafish(561525) dynein, cytoplasmic 1, intermediate chain 1
chicken(420571) dynein, cytoplasmic 1, intermediate chain 1
cow(613724) dynein, cytoplasmic 1, intermediate chain 1
domestic cat(101092506) dynein, cytoplasmic 1, intermediate chain 1
dog(475236) dynein, cytoplasmic 1, intermediate chain 1
domestic guinea pig(100722097) dynein, cytoplasmic 1, intermediate chain 1
naked mole-rat(101699172) dynein, cytoplasmic 1, intermediate chain 1
sheep(101118013) dynein, cytoplasmic 1, intermediate chain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004411 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004411 Rosetta Predictions human pricing
NM_019234 Rosetta Predictions rat pricing
NM_010063 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337554 predicted 1501
2 SASI_Hs01_00052798 predicted 2180
3 SASI_Hs01_00052802 predicted 1780
4 SASI_Hs02_00337555 predicted 2188
5 SASI_Hs01_00052803 predicted 1446
6 SASI_Hs01_00052804 predicted 1598
7 SASI_Hs01_00052805 predicted 1709
8 SASI_Hs01_00052807 predicted 2033
9 SASI_Hs02_00337556 predicted 1989
10 SASI_Hs02_00337557 predicted 1866
11 SASI_Hs01_00052799 predicted 619
12 SASI_Hs01_00052800 predicted 920
13 SASI_Hs01_00052801 predicted 743
14 SASI_Hs01_00052806 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048189 predicted 1740
2 SASI_Rn01_00048190 predicted 1059
3 SASI_Rn01_00048191 predicted 1684
4 SASI_Rn01_00048192 predicted 1227
5 SASI_Rn01_00048193 predicted 2075
6 SASI_Rn01_00048194 predicted 1729
7 SASI_Rn01_00048195 predicted 719
8 SASI_Rn01_00048196 predicted 1314
9 SASI_Rn01_00048197 predicted 567
10 SASI_Rn01_00048198 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317729 predicted 1775
2 SASI_Mm01_00079006 predicted 1843
3 SASI_Mm02_00317730 predicted 1406
4 SASI_Mm02_00317731 predicted 2050
5 SASI_Mm01_00079007 predicted 1393
6 SASI_Mm01_00079008 predicted 1756
7 SASI_Mm02_00317732 predicted 1330
8 SASI_Mm02_00317733 predicted 1833
9 SASI_Mm02_00317734 predicted 1169
10 SASI_Mm02_00317735 predicted 2171
11 SASI_Mm01_00079005 predicted 1163
12 SASI_Mm01_00079009 predicted 1176
13 SASI_Mm01_00079010 predicted 1193
14 SASI_Mm01_00079011 predicted 792
15 SASI_Mm01_00079012 predicted 1263
16 SASI_Mm01_00079013 predicted 1626
17 SASI_Mm01_00079014 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004411
DYNC1I1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 1, intermediate chain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004411.4-496s21c1
Sequence:CCGGTCTAGTGCAGCCGCTGCATTTCTCGAGAAATGCAGCGGCTGCACTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004411.4-2121s21c1
Sequence:CCGGATGATGAATGGACCCGATTTGCTCGAGCAAATCGGGTCCATTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004411.4-2567s21c1
Sequence:CCGGATATGAAGCCAGATATGATTGCTCGAGCAATCATATCTGGCTTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004411.1-2455s1c1
Sequence:CCGGCCTGGCATAGTCCTATTAAATCTCGAGATTTAATAGGACTATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-2059s1c1
Sequence:CCGGCCTTGTGGAAATTCGTGCTAACTCGAGTTAGCACGAATTTCCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-923s1c1
Sequence:CCGGGCTGAAGATTCCGACATCTTTCTCGAGAAAGATGTCGGAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-1017s1c1
Sequence:CCGGGTCAGTTCTATGATGAACATTCTCGAGAATGTTCATCATAGAACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-1016s1c1
Sequence:CCGGCGTCAGTTCTATGATGAACATCTCGAGATGTTCATCATAGAACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004411
DYNC1I1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 1, intermediate chain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004411.4-496s21c1
Sequence:CCGGTCTAGTGCAGCCGCTGCATTTCTCGAGAAATGCAGCGGCTGCACTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004411.4-2121s21c1
Sequence:CCGGATGATGAATGGACCCGATTTGCTCGAGCAAATCGGGTCCATTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004411.4-2567s21c1
Sequence:CCGGATATGAAGCCAGATATGATTGCTCGAGCAATCATATCTGGCTTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004411.1-2455s1c1
Sequence:CCGGCCTGGCATAGTCCTATTAAATCTCGAGATTTAATAGGACTATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-2059s1c1
Sequence:CCGGCCTTGTGGAAATTCGTGCTAACTCGAGTTAGCACGAATTTCCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-923s1c1
Sequence:CCGGGCTGAAGATTCCGACATCTTTCTCGAGAAAGATGTCGGAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-1017s1c1
Sequence:CCGGGTCAGTTCTATGATGAACATTCTCGAGAATGTTCATCATAGAACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-1016s1c1
Sequence:CCGGCGTCAGTTCTATGATGAACATCTCGAGATGTTCATCATAGAACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004411
DYNC1I1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 1, intermediate chain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004411.4-496s21c1
Sequence:CCGGTCTAGTGCAGCCGCTGCATTTCTCGAGAAATGCAGCGGCTGCACTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004411.4-2121s21c1
Sequence:CCGGATGATGAATGGACCCGATTTGCTCGAGCAAATCGGGTCCATTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004411.4-2567s21c1
Sequence:CCGGATATGAAGCCAGATATGATTGCTCGAGCAATCATATCTGGCTTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004411.1-2455s1c1
Sequence:CCGGCCTGGCATAGTCCTATTAAATCTCGAGATTTAATAGGACTATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-2059s1c1
Sequence:CCGGCCTTGTGGAAATTCGTGCTAACTCGAGTTAGCACGAATTTCCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-923s1c1
Sequence:CCGGGCTGAAGATTCCGACATCTTTCTCGAGAAAGATGTCGGAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-1017s1c1
Sequence:CCGGGTCAGTTCTATGATGAACATTCTCGAGAATGTTCATCATAGAACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004411.1-1016s1c1
Sequence:CCGGCGTCAGTTCTATGATGAACATCTCGAGATGTTCATCATAGAACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010063
DYNC1I1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 1, intermediate chain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010063.1-2299s1c1
Sequence:CCGGGCTGTATTTAATAGCTGGAAACTCGAGTTTCCAGCTATTAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-919s1c1
Sequence:CCGGCGTCAGTTCTACGATGAACATCTCGAGATGTTCATCGTAGAACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-1383s1c1
Sequence:CCGGGCTGGTGTATAATAAGTCCAACTCGAGTTGGACTTATTATACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-783s1c1
Sequence:CCGGCATCTTCTTTGACCGGACAATCTCGAGATTGTCCGGTCAAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-1891s1c1
Sequence:CCGGCGCATTTGGATCTATGATGTTCTCGAGAACATCATAGATCCAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010063
DYNC1I1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 1, intermediate chain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010063.1-2299s1c1
Sequence:CCGGGCTGTATTTAATAGCTGGAAACTCGAGTTTCCAGCTATTAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-919s1c1
Sequence:CCGGCGTCAGTTCTACGATGAACATCTCGAGATGTTCATCGTAGAACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-1383s1c1
Sequence:CCGGGCTGGTGTATAATAAGTCCAACTCGAGTTGGACTTATTATACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-783s1c1
Sequence:CCGGCATCTTCTTTGACCGGACAATCTCGAGATTGTCCGGTCAAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-1891s1c1
Sequence:CCGGCGCATTTGGATCTATGATGTTCTCGAGAACATCATAGATCCAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010063
DYNC1I1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 1, intermediate chain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010063.1-2299s1c1
Sequence:CCGGGCTGTATTTAATAGCTGGAAACTCGAGTTTCCAGCTATTAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-919s1c1
Sequence:CCGGCGTCAGTTCTACGATGAACATCTCGAGATGTTCATCGTAGAACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-1383s1c1
Sequence:CCGGGCTGGTGTATAATAAGTCCAACTCGAGTTGGACTTATTATACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-783s1c1
Sequence:CCGGCATCTTCTTTGACCGGACAATCTCGAGATTGTCCGGTCAAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010063.1-1891s1c1
Sequence:CCGGCGCATTTGGATCTATGATGTTCTCGAGAACATCATAGATCCAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks