EMAIL THIS PAGE TO A FRIEND

DYNC1I2

dynein, cytoplasmic 1, intermediate chain 2

79 Gene Product Result for
Synonyms: DNCI2 IC2
Gene ID:
Human(1781) Summary: This gene encodes a member of the dynein intermediate chain family. The encoded protein is a non-catalytic component of the cytoplasmic dynein 1 complex, which acts as a retrograde microtubule motor to transport organelles and vesicles. A pseudogene of this gene is located on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(13427) dynein cytoplasmic 1 intermediate chain 2
Rat(116659) dynein cytoplasmic 1 intermediate chain 2
sheep(101115433) dynein, cytoplasmic 1, intermediate chain 2
naked mole-rat(101701896) dynein, cytoplasmic 1, intermediate chain 2
domestic guinea pig(100721199) dynein, cytoplasmic 1, intermediate chain 2
chicken(424151) dynein, cytoplasmic 1, intermediate chain 2
cow(526329) dynein, cytoplasmic 1, intermediate chain 2
domestic cat(101089708) dynein, cytoplasmic 1, intermediate chain 2
dog(478797) dynein, cytoplasmic 1, intermediate chain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001378 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010064 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010064 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010064 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073601 MISSION® esiRNA esiRNA targeting mouse Dync1i2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001378 Rosetta Predictions human pricing
NM_053880 Rosetta Predictions rat pricing
NM_010064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129736 predicted 633
2 SASI_Hs01_00129737 predicted 1431
3 SASI_Hs02_00331729 predicted 896
4 SASI_Hs01_00129739 predicted 1238
5 SASI_Hs01_00129740 predicted 1906
6 SASI_Hs01_00129741 predicted 1493
7 SASI_Hs01_00129742 predicted 643
8 SASI_Hs01_00129744 predicted 935
9 SASI_Hs01_00129745 predicted 1661
10 SASI_Hs02_00331730 predicted 617
11 SASI_Hs01_00129738 predicted 1629
12 SASI_Hs01_00129743 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074106 predicted 1618
2 SASI_Rn01_00074107 predicted 1210
3 SASI_Rn01_00074108 predicted 517
4 SASI_Rn01_00074109 predicted 1815
5 SASI_Rn01_00074110 predicted 933
6 SASI_Rn01_00074112 predicted 1529
7 SASI_Rn01_00074113 predicted 1147
8 SASI_Rn01_00074114 predicted 1129
9 SASI_Rn01_00074115 predicted 1999
10 SASI_Rn02_00266788 predicted 1417
11 SASI_Rn01_00074111 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042754 predicted 1542
2 SASI_Mm01_00042756 predicted 1734
3 SASI_Mm01_00042757 predicted 1571
4 SASI_Mm02_00317736 predicted 1506
5 SASI_Mm01_00042758 predicted 1477
6 SASI_Mm01_00042759 predicted 1253
7 SASI_Mm01_00042760 predicted 590
8 SASI_Mm01_00042761 predicted 934
9 SASI_Mm01_00042762 predicted 1457
10 SASI_Mm01_00042763 predicted 438
11 SASI_Mm01_00042755 predicted 1145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001378
VALIDATED
DYNC1I2 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 1, intermediate chain 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001378.1-2444s1c1
Sequence:CCGGCCCTGTTATACAGATAATGTTCTCGAGAACATTATCTGTATAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001378.1-700s1c1
Sequence:CCGGGTGGCTCCTAAACCACCTATTCTCGAGAATAGGTGGTTTAGGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001378.1-1735s1c1
Sequence:CCGGGCAGACTATGTTTATGATGTTCTCGAGAACATCATAAACATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001378.1-946s1c1
Sequence:CCGGGCAGGTGCTAAACTGTCATTACTCGAGTAATGACAGTTTAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001378.1-555s21c1
Sequence:CCGGTTTGGGACGAGGACCTATTAACTCGAGTTAATAGGTCCTCGTCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001378.1-946s21c1
Sequence:CCGGGCAGGTGCTAAACTGTCATTACTCGAGTAATGACAGTTTAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001378.1-2444s21c1
Sequence:CCGGCCCTGTTATACAGATAATGTTCTCGAGAACATTATCTGTATAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001378.1-531s21c1
Sequence:CCGGTCTTCAGCTTCACTCAGATTCCTCGAGGAATCTGAGTGAAGCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001378
VALIDATED
DYNC1I2 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 1, intermediate chain 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001378.1-2444s1c1
Sequence:CCGGCCCTGTTATACAGATAATGTTCTCGAGAACATTATCTGTATAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001378.1-700s1c1
Sequence:CCGGGTGGCTCCTAAACCACCTATTCTCGAGAATAGGTGGTTTAGGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001378.1-1735s1c1
Sequence:CCGGGCAGACTATGTTTATGATGTTCTCGAGAACATCATAAACATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001378.1-946s1c1
Sequence:CCGGGCAGGTGCTAAACTGTCATTACTCGAGTAATGACAGTTTAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001378.1-555s21c1
Sequence:CCGGTTTGGGACGAGGACCTATTAACTCGAGTTAATAGGTCCTCGTCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001378.1-946s21c1
Sequence:CCGGGCAGGTGCTAAACTGTCATTACTCGAGTAATGACAGTTTAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001378.1-2444s21c1
Sequence:CCGGCCCTGTTATACAGATAATGTTCTCGAGAACATTATCTGTATAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001378.1-531s21c1
Sequence:CCGGTCTTCAGCTTCACTCAGATTCCTCGAGGAATCTGAGTGAAGCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001378
VALIDATED
DYNC1I2 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 1, intermediate chain 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001378.1-2444s1c1
Sequence:CCGGCCCTGTTATACAGATAATGTTCTCGAGAACATTATCTGTATAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001378.1-700s1c1
Sequence:CCGGGTGGCTCCTAAACCACCTATTCTCGAGAATAGGTGGTTTAGGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001378.1-1735s1c1
Sequence:CCGGGCAGACTATGTTTATGATGTTCTCGAGAACATCATAAACATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001378.1-946s1c1
Sequence:CCGGGCAGGTGCTAAACTGTCATTACTCGAGTAATGACAGTTTAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001378.1-555s21c1
Sequence:CCGGTTTGGGACGAGGACCTATTAACTCGAGTTAATAGGTCCTCGTCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001378.1-946s21c1
Sequence:CCGGGCAGGTGCTAAACTGTCATTACTCGAGTAATGACAGTTTAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001378.1-2444s21c1
Sequence:CCGGCCCTGTTATACAGATAATGTTCTCGAGAACATTATCTGTATAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001378.1-531s21c1
Sequence:CCGGTCTTCAGCTTCACTCAGATTCCTCGAGGAATCTGAGTGAAGCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010064
VALIDATED
DYNC1I2 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 1, intermediate chain 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010064.1-1985s1c1
Sequence:CCGGGCTTCTGATTAAATGAGTGTTCTCGAGAACACTCATTTAATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010064.1-822s1c1
Sequence:CCGGCGTTGGTCAAAGCATCGAGTTCTCGAGAACTCGATGCTTTGACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010064.1-1843s1c1
Sequence:CCGGGCCGAACACTCGCAGAAATTACTCGAGTAATTTCTGCGAGTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010064.1-791s1c1
Sequence:CCGGGCTGTCATTAAATCGACAGTTCTCGAGAACTGTCGATTTAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010064.1-941s1c1
Sequence:CCGGCGTGTGGAATATGAAGTACAACTCGAGTTGTACTTCATATTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-1254s21c1
Sequence:CCGGAGCATGGAGTTGGTTCATAAACTCGAGTTTATGAACCAACTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-384s21c1
Sequence:CCGGTCTAGACGAGGACCTATTAAACTCGAGTTTAATAGGTCCTCGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-2013s21c1
Sequence:CCGGATGGATAATCTGGGTTTAATACTCGAGTATTAAACCCAGATTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-875s21c1
Sequence:CCGGACTTGTGGCTTCCTATAATAACTCGAGTTATTATAGGAAGCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-1837s21c1
Sequence:CCGGGCCGAACACTCGCAGAAATTACTCGAGTAATTTCTGCGAGTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010064
VALIDATED
DYNC1I2 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 1, intermediate chain 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010064.1-1985s1c1
Sequence:CCGGGCTTCTGATTAAATGAGTGTTCTCGAGAACACTCATTTAATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010064.1-822s1c1
Sequence:CCGGCGTTGGTCAAAGCATCGAGTTCTCGAGAACTCGATGCTTTGACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010064.1-1843s1c1
Sequence:CCGGGCCGAACACTCGCAGAAATTACTCGAGTAATTTCTGCGAGTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010064.1-791s1c1
Sequence:CCGGGCTGTCATTAAATCGACAGTTCTCGAGAACTGTCGATTTAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010064.1-941s1c1
Sequence:CCGGCGTGTGGAATATGAAGTACAACTCGAGTTGTACTTCATATTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-1254s21c1
Sequence:CCGGAGCATGGAGTTGGTTCATAAACTCGAGTTTATGAACCAACTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-384s21c1
Sequence:CCGGTCTAGACGAGGACCTATTAAACTCGAGTTTAATAGGTCCTCGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-2013s21c1
Sequence:CCGGATGGATAATCTGGGTTTAATACTCGAGTATTAAACCCAGATTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-875s21c1
Sequence:CCGGACTTGTGGCTTCCTATAATAACTCGAGTTATTATAGGAAGCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-1837s21c1
Sequence:CCGGGCCGAACACTCGCAGAAATTACTCGAGTAATTTCTGCGAGTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010064
VALIDATED
DYNC1I2 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 1, intermediate chain 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010064.1-1985s1c1
Sequence:CCGGGCTTCTGATTAAATGAGTGTTCTCGAGAACACTCATTTAATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010064.1-822s1c1
Sequence:CCGGCGTTGGTCAAAGCATCGAGTTCTCGAGAACTCGATGCTTTGACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010064.1-1843s1c1
Sequence:CCGGGCCGAACACTCGCAGAAATTACTCGAGTAATTTCTGCGAGTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010064.1-791s1c1
Sequence:CCGGGCTGTCATTAAATCGACAGTTCTCGAGAACTGTCGATTTAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010064.1-941s1c1
Sequence:CCGGCGTGTGGAATATGAAGTACAACTCGAGTTGTACTTCATATTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-1254s21c1
Sequence:CCGGAGCATGGAGTTGGTTCATAAACTCGAGTTTATGAACCAACTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-384s21c1
Sequence:CCGGTCTAGACGAGGACCTATTAAACTCGAGTTTAATAGGTCCTCGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-2013s21c1
Sequence:CCGGATGGATAATCTGGGTTTAATACTCGAGTATTAAACCCAGATTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-875s21c1
Sequence:CCGGACTTGTGGCTTCCTATAATAACTCGAGTTATTATAGGAAGCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010064.3-1837s21c1
Sequence:CCGGGCCGAACACTCGCAGAAATTACTCGAGTAATTTCTGCGAGTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks