EMAIL THIS PAGE TO A FRIEND

DYNC1LI1

dynein, cytoplasmic 1, light intermediate chain 1

Synonyms: DNCLI1 LIC1
UniProtKB ID: Q9Y6G9, A2RRG7, Q53HC8, Q53HK7
Gene ID:
Mouse(235661) dynein cytoplasmic 1 light intermediate chain 1
Rat(252902) dynein cytoplasmic 1 light intermediate chain 1
Zebrafish(556103) dynein, cytoplasmic 1, light intermediate chain 1
chicken(420668) dynein, cytoplasmic 1, light intermediate chain 1
dog(477038) dynein, cytoplasmic 1, light intermediate chain 1
domestic cat(101093542) dynein, cytoplasmic 1, light intermediate chain 1
cow(510330) dynein, cytoplasmic 1, light intermediate chain 1
domestic guinea pig(100716888) dynein, cytoplasmic 1, light intermediate chain 1
naked mole-rat(101710373) dynein, cytoplasmic 1, light intermediate chain 1
sheep(101112428) dynein, cytoplasmic 1, light intermediate chain 1
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055131 MISSION® esiRNA esiRNA human DYNC1LI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016141 Rosetta Predictions human pricing
NM_145772 Rosetta Predictions rat pricing
NM_146229 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159813 predicted 719
2 SASI_Hs01_00159814 predicted 797
3 SASI_Hs01_00159815 predicted 666
4 SASI_Hs01_00159816 predicted 829
5 SASI_Hs01_00159817 predicted 422
6 SASI_Hs01_00159818 predicted 926
7 SASI_Hs01_00159820 predicted 889
8 SASI_Hs01_00159819 predicted 724
9 SASI_Hs01_00159821 predicted 1143
10 SASI_Hs01_00159822 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063125 predicted 891
2 SASI_Rn01_00063127 predicted 1091
3 SASI_Rn01_00063128 predicted 313
4 SASI_Rn01_00063129 predicted 361
5 SASI_Rn01_00063130 predicted 902
6 SASI_Rn01_00063131 predicted 1348
7 SASI_Rn01_00063132 predicted 858
8 SASI_Rn01_00063133 predicted 467
9 SASI_Rn02_00268772 predicted 522
10 SASI_Rn01_00063134 predicted 881
11 SASI_Rn01_00063126 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341928 predicted 925
2 SASI_Mm02_00341929 predicted 792
3 SASI_Mm02_00341930 predicted 1521
4 SASI_Mm02_00341931 predicted 305
5 SASI_Mm02_00341932 predicted 885
6 SASI_Mm02_00341933 predicted 1375
7 SASI_Mm02_00341934 predicted 389
8 SASI_Mm02_00341935 predicted 539
9 SASI_Mm02_00341936 predicted 247
10 SASI_Mm02_00341937 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016141
VALIDATED
DYNC1LI1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 1, light intermediate chain 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016141.2-772s21c1
Sequence:GTACCGGTGCGGATACACTTACACATAACTCGAGTTATGTGTAAGTGTATCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016141.2-560s21c1
Sequence:CCGGGCTTTGGATTCTTTACAGAAACTCGAGTTTCTGTAAAGAATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016141.1-921s1c2
Sequence:CCGGGCACTTATTTACACTTCAGTACTCGAGTACTGAAGTGTAAATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016141.1-507s1c2
Sequence:CCGGGATACTCTAGTTATGCTGGTTCTCGAGAACCAGCATAACTAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016141.2-1010s21c1
Sequence:CCGGCCCTATAAGATTCCTGCTGTTCTCGAGAACAGCAGGAATCTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016141.2-929s21c1
Sequence:CCGGGCACTTATTTACACTTCAGTACTCGAGTACTGAAGTGTAAATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016141.2-1943s21c1
Sequence:GTACCGGGCCATGTGATCGATCATATTCCTCGAGGAATATGATCGATCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_016141.2-515s21c1
Sequence:CCGGGATACTCTAGTTATGCTGGTTCTCGAGAACCAGCATAACTAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016141.1-1946s1c1
Sequence:CCGGCGATCATATTCTAAAGGCTATCTCGAGATAGCCTTTAGAATATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016141.1-552s1c1
Sequence:CCGGGCTTTGGATTCTTTACAGAAACTCGAGTTTCTGTAAAGAATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016141.1-1002s1c1
Sequence:CCGGCCCTATAAGATTCCTGCTGTTCTCGAGAACAGCAGGAATCTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016141
VALIDATED
DYNC1LI1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 1, light intermediate chain 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016141.2-772s21c1
Sequence:GTACCGGTGCGGATACACTTACACATAACTCGAGTTATGTGTAAGTGTATCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016141.2-560s21c1
Sequence:CCGGGCTTTGGATTCTTTACAGAAACTCGAGTTTCTGTAAAGAATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016141.1-921s1c2
Sequence:CCGGGCACTTATTTACACTTCAGTACTCGAGTACTGAAGTGTAAATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016141.1-507s1c2
Sequence:CCGGGATACTCTAGTTATGCTGGTTCTCGAGAACCAGCATAACTAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016141.2-1010s21c1
Sequence:CCGGCCCTATAAGATTCCTGCTGTTCTCGAGAACAGCAGGAATCTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016141.2-929s21c1
Sequence:CCGGGCACTTATTTACACTTCAGTACTCGAGTACTGAAGTGTAAATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016141.2-1943s21c1
Sequence:GTACCGGGCCATGTGATCGATCATATTCCTCGAGGAATATGATCGATCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_016141.2-515s21c1
Sequence:CCGGGATACTCTAGTTATGCTGGTTCTCGAGAACCAGCATAACTAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016141.1-1946s1c1
Sequence:CCGGCGATCATATTCTAAAGGCTATCTCGAGATAGCCTTTAGAATATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016141.1-552s1c1
Sequence:CCGGGCTTTGGATTCTTTACAGAAACTCGAGTTTCTGTAAAGAATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016141.1-1002s1c1
Sequence:CCGGCCCTATAAGATTCCTGCTGTTCTCGAGAACAGCAGGAATCTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016141
VALIDATED
DYNC1LI1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 1, light intermediate chain 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016141.2-772s21c1
Sequence:GTACCGGTGCGGATACACTTACACATAACTCGAGTTATGTGTAAGTGTATCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016141.2-560s21c1
Sequence:CCGGGCTTTGGATTCTTTACAGAAACTCGAGTTTCTGTAAAGAATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016141.1-921s1c2
Sequence:CCGGGCACTTATTTACACTTCAGTACTCGAGTACTGAAGTGTAAATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016141.1-507s1c2
Sequence:CCGGGATACTCTAGTTATGCTGGTTCTCGAGAACCAGCATAACTAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016141.2-1010s21c1
Sequence:CCGGCCCTATAAGATTCCTGCTGTTCTCGAGAACAGCAGGAATCTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016141.2-929s21c1
Sequence:CCGGGCACTTATTTACACTTCAGTACTCGAGTACTGAAGTGTAAATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016141.2-1943s21c1
Sequence:GTACCGGGCCATGTGATCGATCATATTCCTCGAGGAATATGATCGATCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_016141.2-515s21c1
Sequence:CCGGGATACTCTAGTTATGCTGGTTCTCGAGAACCAGCATAACTAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016141.1-1946s1c1
Sequence:CCGGCGATCATATTCTAAAGGCTATCTCGAGATAGCCTTTAGAATATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016141.1-552s1c1
Sequence:CCGGGCTTTGGATTCTTTACAGAAACTCGAGTTTCTGTAAAGAATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016141.1-1002s1c1
Sequence:CCGGCCCTATAAGATTCCTGCTGTTCTCGAGAACAGCAGGAATCTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146229
DYNC1LI1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 1, light intermediate chain 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146229.2-881s21c1
Sequence:GTACCGGAGTATGGCGCAGCGCTGATTTCTCGAGAAATCAGCGCTGCGCCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146229.2-486s21c1
Sequence:GTACCGGGGTCATGTTGGTTGTTGATATCTCGAGATATCAACAACCAACATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146229.1-1895s1c1
Sequence:CCGGGCTGGCCTCAAACTCAGAAATCTCGAGATTTCTGAGTTTGAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-1120s1c1
Sequence:CCGGCCTGTCAGAAAGTTCGTGCATCTCGAGATGCACGAACTTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-1545s1c1
Sequence:CCGGGCTAGACAGAATCACACGGAACTCGAGTTCCGTGTGATTCTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-894s1c1
Sequence:CCGGGCTGATTTACACTTCAGTAAACTCGAGTTTACTGAAGTGTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-612s1c1
Sequence:CCGGGCAGAAGTTGATTAGAGACTTCTCGAGAAGTCTCTAATCAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146229
DYNC1LI1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 1, light intermediate chain 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146229.2-881s21c1
Sequence:GTACCGGAGTATGGCGCAGCGCTGATTTCTCGAGAAATCAGCGCTGCGCCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146229.2-486s21c1
Sequence:GTACCGGGGTCATGTTGGTTGTTGATATCTCGAGATATCAACAACCAACATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146229.1-1895s1c1
Sequence:CCGGGCTGGCCTCAAACTCAGAAATCTCGAGATTTCTGAGTTTGAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-1120s1c1
Sequence:CCGGCCTGTCAGAAAGTTCGTGCATCTCGAGATGCACGAACTTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-1545s1c1
Sequence:CCGGGCTAGACAGAATCACACGGAACTCGAGTTCCGTGTGATTCTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-894s1c1
Sequence:CCGGGCTGATTTACACTTCAGTAAACTCGAGTTTACTGAAGTGTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-612s1c1
Sequence:CCGGGCAGAAGTTGATTAGAGACTTCTCGAGAAGTCTCTAATCAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146229
DYNC1LI1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 1, light intermediate chain 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146229.2-881s21c1
Sequence:GTACCGGAGTATGGCGCAGCGCTGATTTCTCGAGAAATCAGCGCTGCGCCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146229.2-486s21c1
Sequence:GTACCGGGGTCATGTTGGTTGTTGATATCTCGAGATATCAACAACCAACATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146229.1-1895s1c1
Sequence:CCGGGCTGGCCTCAAACTCAGAAATCTCGAGATTTCTGAGTTTGAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-1120s1c1
Sequence:CCGGCCTGTCAGAAAGTTCGTGCATCTCGAGATGCACGAACTTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-1545s1c1
Sequence:CCGGGCTAGACAGAATCACACGGAACTCGAGTTCCGTGTGATTCTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-894s1c1
Sequence:CCGGGCTGATTTACACTTCAGTAAACTCGAGTTTACTGAAGTGTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146229.1-612s1c1
Sequence:CCGGGCAGAAGTTGATTAGAGACTTCTCGAGAAGTCTCTAATCAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks