EMAIL THIS PAGE TO A FRIEND

DYNC1LI2

dynein, cytoplasmic 1, light intermediate chain 2

Synonyms: DNCLI2 LIC2
UniProtKB ID: O43237, A8K6V1, Q8TAT3
Gene ID:
Human(1783) Summary: Cytoplasmic dynein is a microtubule-associated motor protein (Hughes et al., 1995 [PubMed 7738094]
Mouse(234663) dynein, cytoplasmic 1 light intermediate chain 2
Rat(81655) dynein, cytoplasmic 1 light intermediate chain 2
sheep(101108246) dynein, cytoplasmic 1, light intermediate chain 2
naked mole-rat(101702724) dynein, cytoplasmic 1, light intermediate chain 2
domestic guinea pig(100715806) dynein, cytoplasmic 1, light intermediate chain 2
Zebrafish(573266) dynein, cytoplasmic 1, light intermediate chain 2
chicken(415793) dynein, cytoplasmic 1, light intermediate chain 2
dog(479693) dynein, cytoplasmic 1, light intermediate chain 2
cow(519789) dynein, cytoplasmic 1, light intermediate chain 2
domestic cat(101095299) dynein, cytoplasmic 1, light intermediate chain 2
237 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006141 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006141 Rosetta Predictions human pricing
NM_031026 Rosetta Predictions rat pricing
NM_001013380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014533 predicted 1022
2 SASI_Hs01_00014534 predicted 204
3 SASI_Hs01_00014535 predicted 822
4 SASI_Hs02_00340976 predicted 865
5 SASI_Hs02_00340977 predicted 1082
6 SASI_Hs02_00340978 predicted 370
7 SASI_Hs01_00014538 predicted 875
8 SASI_Hs01_00014539 predicted 675
9 SASI_Hs01_00014540 predicted 365
10 SASI_Hs01_00014541 predicted 863
11 SASI_Hs01_00014536 predicted 1039
12 SASI_Hs01_00014537 predicted 782
13 SASI_Hs01_00014542 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105443 predicted 1237
2 SASI_Rn01_00105444 predicted 1321
3 SASI_Rn01_00105445 predicted 1512
4 SASI_Rn01_00105446 predicted 794
5 SASI_Rn01_00105447 predicted 262
6 SASI_Rn02_00264226 predicted 451
7 SASI_Rn01_00105448 predicted 1429
8 SASI_Rn01_00105449 predicted 1530
9 SASI_Rn01_00105450 predicted 409
10 SASI_Rn01_00105451 predicted 1514
11 SASI_Rn01_00105452 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172429 predicted 1478
2 SASI_Mm01_00172431 predicted 464
3 SASI_Mm01_00172432 predicted 1699
4 SASI_Mm01_00172433 predicted 725
5 SASI_Mm01_00172434 predicted 536
6 SASI_Mm01_00172435 predicted 551
7 SASI_Mm01_00172436 predicted 385
8 SASI_Mm01_00172437 predicted 642
9 SASI_Mm01_00172438 predicted 1501
10 SASI_Mm02_00287209 predicted 1605
11 SASI_Mm01_00172430 predicted 1238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013380
VALIDATED
DYNC1LI2 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 1, light intermediate chain 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-2714s1c1
Sequence:CCGGCCTCCCTGATACAGAAAGGTTCTCGAGAACCTTTCTGTATCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-300s1c1
Sequence:CCGGCCAGAGTCTATGGTCTTCGATCTCGAGATCGAAGACCATAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-1617s1c1
Sequence:CCGGACTGGATAGAATGACTCGAAACTCGAGTTTCGAGTCATTCTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013380.1-921s1c1
Sequence:CCGGCTTGGAGAAGGAGCACGATTACTCGAGTAATCGTGCTCCTTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-384s1c1
Sequence:CCGGCGGTGAAGATGGTTCTGGTAACTCGAGTTACCAGAACCATCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013380
VALIDATED
DYNC1LI2 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 1, light intermediate chain 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-2714s1c1
Sequence:CCGGCCTCCCTGATACAGAAAGGTTCTCGAGAACCTTTCTGTATCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-300s1c1
Sequence:CCGGCCAGAGTCTATGGTCTTCGATCTCGAGATCGAAGACCATAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-1617s1c1
Sequence:CCGGACTGGATAGAATGACTCGAAACTCGAGTTTCGAGTCATTCTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013380.1-921s1c1
Sequence:CCGGCTTGGAGAAGGAGCACGATTACTCGAGTAATCGTGCTCCTTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-384s1c1
Sequence:CCGGCGGTGAAGATGGTTCTGGTAACTCGAGTTACCAGAACCATCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013380
VALIDATED
DYNC1LI2 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 1, light intermediate chain 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-2714s1c1
Sequence:CCGGCCTCCCTGATACAGAAAGGTTCTCGAGAACCTTTCTGTATCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-300s1c1
Sequence:CCGGCCAGAGTCTATGGTCTTCGATCTCGAGATCGAAGACCATAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-1617s1c1
Sequence:CCGGACTGGATAGAATGACTCGAAACTCGAGTTTCGAGTCATTCTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013380.1-921s1c1
Sequence:CCGGCTTGGAGAAGGAGCACGATTACTCGAGTAATCGTGCTCCTTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013380.1-384s1c1
Sequence:CCGGCGGTGAAGATGGTTCTGGTAACTCGAGTTACCAGAACCATCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006141
DYNC1LI2 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 1, light intermediate chain 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006141.2-3748s1c1
Sequence:CCGGGCCAAATAATAAACAGCCTTTCTCGAGAAAGGCTGTTTATTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-868s1c1
Sequence:CCGGCCTCGACTTGTTGTATAAGTACTCGAGTACTTATACAACAAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-453s1c1
Sequence:CCGGGACCTTGGACTGTGATGGAATCTCGAGATTCCATCACAGTCCAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-1082s1c1
Sequence:CCGGGACAAAGAGTTGGCAGCAGAACTCGAGTTCTGCTGCCAACTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-1461s1c1
Sequence:CCGGGAAAGCCAGACTCTATGGTAACTCGAGTTACCATAGAGTCTGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-212s21c1
Sequence:CCGGGGTGAAGATGGTTCTGGTAAACTCGAGTTTACCAGAACCATCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-1501s21c1
Sequence:CCGGTGAAGCCTGAACCTCCTTAAACTCGAGTTTAAGGAGGTTCAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006141.2-1662s21c1
Sequence:CCGGCCGAGTGTGAAATGCACATTTCTCGAGAAATGTGCATTTCACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-676s21c1
Sequence:CCGGTGACAATGTGCTGACTCATAACTCGAGTTATGAGTCAGCACATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-497s21c1
Sequence:CCGGTTACGTGAGCACATTGATAAACTCGAGTTTATCAATGTGCTCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006141.2-1901s21c1
Sequence:CCGGGTTCTTGGGAAGCAGATTAAGCTCGAGCTTAATCTGCTTCCCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006141
DYNC1LI2 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 1, light intermediate chain 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006141.2-3748s1c1
Sequence:CCGGGCCAAATAATAAACAGCCTTTCTCGAGAAAGGCTGTTTATTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-868s1c1
Sequence:CCGGCCTCGACTTGTTGTATAAGTACTCGAGTACTTATACAACAAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-453s1c1
Sequence:CCGGGACCTTGGACTGTGATGGAATCTCGAGATTCCATCACAGTCCAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-1082s1c1
Sequence:CCGGGACAAAGAGTTGGCAGCAGAACTCGAGTTCTGCTGCCAACTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-1461s1c1
Sequence:CCGGGAAAGCCAGACTCTATGGTAACTCGAGTTACCATAGAGTCTGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-212s21c1
Sequence:CCGGGGTGAAGATGGTTCTGGTAAACTCGAGTTTACCAGAACCATCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-1501s21c1
Sequence:CCGGTGAAGCCTGAACCTCCTTAAACTCGAGTTTAAGGAGGTTCAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006141.2-1662s21c1
Sequence:CCGGCCGAGTGTGAAATGCACATTTCTCGAGAAATGTGCATTTCACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-676s21c1
Sequence:CCGGTGACAATGTGCTGACTCATAACTCGAGTTATGAGTCAGCACATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-497s21c1
Sequence:CCGGTTACGTGAGCACATTGATAAACTCGAGTTTATCAATGTGCTCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006141.2-1901s21c1
Sequence:CCGGGTTCTTGGGAAGCAGATTAAGCTCGAGCTTAATCTGCTTCCCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006141
DYNC1LI2 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 1, light intermediate chain 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006141.2-3748s1c1
Sequence:CCGGGCCAAATAATAAACAGCCTTTCTCGAGAAAGGCTGTTTATTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-868s1c1
Sequence:CCGGCCTCGACTTGTTGTATAAGTACTCGAGTACTTATACAACAAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-453s1c1
Sequence:CCGGGACCTTGGACTGTGATGGAATCTCGAGATTCCATCACAGTCCAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-1082s1c1
Sequence:CCGGGACAAAGAGTTGGCAGCAGAACTCGAGTTCTGCTGCCAACTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006141.2-1461s1c1
Sequence:CCGGGAAAGCCAGACTCTATGGTAACTCGAGTTACCATAGAGTCTGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-212s21c1
Sequence:CCGGGGTGAAGATGGTTCTGGTAAACTCGAGTTTACCAGAACCATCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-1501s21c1
Sequence:CCGGTGAAGCCTGAACCTCCTTAAACTCGAGTTTAAGGAGGTTCAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006141.2-1662s21c1
Sequence:CCGGCCGAGTGTGAAATGCACATTTCTCGAGAAATGTGCATTTCACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-676s21c1
Sequence:CCGGTGACAATGTGCTGACTCATAACTCGAGTTATGAGTCAGCACATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006141.2-497s21c1
Sequence:CCGGTTACGTGAGCACATTGATAAACTCGAGTTTATCAATGTGCTCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006141.2-1901s21c1
Sequence:CCGGGTTCTTGGGAAGCAGATTAAGCTCGAGCTTAATCTGCTTCCCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks