EMAIL THIS PAGE TO A FRIEND

DYNC2H1

dynein, cytoplasmic 2, heavy chain 1

Synonyms: ATD3 DHC1b DHC2 DNCH2 DYH1B SRPS2B hdhc11
Gene ID:
Human(79659) Summary: This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
Mouse(110350) dynein cytoplasmic 2 heavy chain 1
Rat(65209) dynein cytoplasmic 2 heavy chain 1
Zebrafish(562754) dynein cytoplasmic 2 heavy chain 1
cow(512287) dynein, cytoplasmic 2, heavy chain 1
domestic cat(101082005) dynein, cytoplasmic 2, heavy chain 1
dog(479461) dynein, cytoplasmic 2, heavy chain 1
chicken(418979) dynein, cytoplasmic 2, heavy chain 1
domestic guinea pig(100729376) dynein, cytoplasmic 2, heavy chain 1
naked mole-rat(101698011) dynein, cytoplasmic 2, heavy chain 1
sheep(101118215) dynein, cytoplasmic 2, heavy chain 1
Gene Class: ATPase
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_370652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370652 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080463 Rosetta Predictions human pricing
XM_370652 Rosetta Predictions human pricing
XM_931085 Rosetta Predictions human pricing
NM_023024 Rosetta Predictions rat pricing
NM_029851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315076 predicted 11501
2 SASI_Hs02_00315077 predicted 9281
3 SASI_Hs02_00315078 predicted 11314
4 SASI_Hs02_00315079 predicted 11275
5 SASI_Hs02_00315080 predicted 6167
6 SASI_Hs02_00315081 predicted 4801
7 SASI_Hs02_00315082 predicted 7841
8 SASI_Hs02_00315083 predicted 11942
9 SASI_Hs02_00315084 predicted 3644
10 SASI_Hs02_00315085 predicted 7721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255374 predicted 2121
2 SASI_Hs01_00255375 predicted 1019
3 SASI_Hs01_00255376 predicted 953
4 SASI_Hs01_00255377 predicted 1620
5 SASI_Hs01_00255378 predicted 1140
6 SASI_Hs01_00255379 predicted 1117
7 SASI_Hs01_00255380 predicted 409
8 SASI_Hs01_00255381 predicted 439
9 SASI_Hs01_00255382 predicted 990
10 SASI_Hs01_00255383 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253957 predicted 2294
2 SASI_Hs01_00253958 predicted 2524
3 SASI_Hs01_00253959 predicted 2099
4 SASI_Hs01_00253960 predicted 2260
5 SASI_Hs01_00253961 predicted 1107
6 SASI_Hs01_00253962 predicted 2273
7 SASI_Hs01_00253963 predicted 873
8 SASI_Hs01_00253964 predicted 958
9 SASI_Hs01_00253965 predicted 1120
10 SASI_Hs01_00253966 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055739 predicted 7935
2 SASI_Rn01_00055740 predicted 2986
3 SASI_Rn01_00055741 predicted 11615
4 SASI_Rn02_00263712 predicted 3297
5 SASI_Rn01_00055743 predicted 6224
6 SASI_Rn02_00263713 predicted 11014
7 SASI_Rn02_00263714 predicted 8213
8 SASI_Rn01_00055748 predicted 3835
9 SASI_Rn02_00263715 predicted 4471
10 SASI_Rn02_00263716 predicted 7804
11 SASI_Rn01_00055742 predicted 443
12 SASI_Rn01_00055744 predicted 11371
13 SASI_Rn01_00055745 predicted 3250
14 SASI_Rn01_00055746 predicted 6206
15 SASI_Rn01_00055747 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101126 predicted 7624
2 SASI_Mm01_00101127 predicted 5923
3 SASI_Mm02_00336075 predicted 6256
4 SASI_Mm01_00101128 predicted 3948
5 SASI_Mm01_00101129 predicted 3602
6 SASI_Mm02_00336076 predicted 4396
7 SASI_Mm01_00101130 predicted 13085
8 SASI_Mm01_00101131 predicted 11822
9 SASI_Mm01_00101134 predicted 12737
10 SASI_Mm01_00101135 predicted 7781
11 SASI_Mm01_00101132 predicted 7916
12 SASI_Mm01_00101133 predicted 4178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080463
DYNC2H1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 2, heavy chain 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-3489s21c1
Sequence:CCGGCCTGGCAAGTAGTATCTCTAACTCGAGTTAGAGATACTACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-5891s21c1
Sequence:CCGGCCCGGTTTGATGCACTGATAACTCGAGTTATCAGTGCATCAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-7738s21c1
Sequence:CCGGCGGCGCTTATTTCGTGACAAACTCGAGTTTGTCACGAAATAAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-10660s21c1
Sequence:CCGGGCCAGCAAGATGTACTTCATTCTCGAGAATGAAGTACATCTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-1252s21c1
Sequence:CCGGCCTGTGCAATATAATCCATATCTCGAGATATGGATTATATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080463
DYNC2H1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 2, heavy chain 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-3489s21c1
Sequence:CCGGCCTGGCAAGTAGTATCTCTAACTCGAGTTAGAGATACTACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-5891s21c1
Sequence:CCGGCCCGGTTTGATGCACTGATAACTCGAGTTATCAGTGCATCAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-7738s21c1
Sequence:CCGGCGGCGCTTATTTCGTGACAAACTCGAGTTTGTCACGAAATAAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-10660s21c1
Sequence:CCGGGCCAGCAAGATGTACTTCATTCTCGAGAATGAAGTACATCTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-1252s21c1
Sequence:CCGGCCTGTGCAATATAATCCATATCTCGAGATATGGATTATATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080463
DYNC2H1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 2, heavy chain 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-3489s21c1
Sequence:CCGGCCTGGCAAGTAGTATCTCTAACTCGAGTTAGAGATACTACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-5891s21c1
Sequence:CCGGCCCGGTTTGATGCACTGATAACTCGAGTTATCAGTGCATCAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-7738s21c1
Sequence:CCGGCGGCGCTTATTTCGTGACAAACTCGAGTTTGTCACGAAATAAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-10660s21c1
Sequence:CCGGGCCAGCAAGATGTACTTCATTCTCGAGAATGAAGTACATCTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080463.1-1252s21c1
Sequence:CCGGCCTGTGCAATATAATCCATATCTCGAGATATGGATTATATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029851
VALIDATED
DYNC2H1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 2, heavy chain 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029851.2-13212s1c1
Sequence:CCGGGTATTTGGTGGTAGGTATTAACTCGAGTTAATACCTACCACCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-8849s1c1
Sequence:CCGGGAGTATCCTGCTTCGAATAAACTCGAGTTTATTCGAAGCAGGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029851.2-13212s21c1
Sequence:CCGGGTATTTGGTGGTAGGTATTAACTCGAGTTAATACCTACCACCAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029851.2-1754s21c1
Sequence:CCGGTGAGGCTAACAGCCGAATAATCTCGAGATTATTCGGCTGTTAGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029851.2-6893s21c1
Sequence:CCGGGCAGCGAGGTTTAGATTATTTCTCGAGAAATAATCTAAACCTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029851.2-8849s21c1
Sequence:CCGGGAGTATCCTGCTTCGAATAAACTCGAGTTTATTCGAAGCAGGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029851.2-10506s21c1
Sequence:CCGGTCACTTAAGGAATCGTATAAACTCGAGTTTATACGATTCCTTAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-6489s1c1
Sequence:CCGGCCTCTTGAATACAGAAGTAATCTCGAGATTACTTCTGTATTCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-11517s1c1
Sequence:CCGGGCAGAAGTTCATCCCAACTTTCTCGAGAAAGTTGGGATGAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-4188s1c1
Sequence:CCGGCGCTTCAACAAAGTTGATGAACTCGAGTTCATCAACTTTGTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029851
VALIDATED
DYNC2H1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 2, heavy chain 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029851.2-13212s1c1
Sequence:CCGGGTATTTGGTGGTAGGTATTAACTCGAGTTAATACCTACCACCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-8849s1c1
Sequence:CCGGGAGTATCCTGCTTCGAATAAACTCGAGTTTATTCGAAGCAGGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029851.2-13212s21c1
Sequence:CCGGGTATTTGGTGGTAGGTATTAACTCGAGTTAATACCTACCACCAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029851.2-1754s21c1
Sequence:CCGGTGAGGCTAACAGCCGAATAATCTCGAGATTATTCGGCTGTTAGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029851.2-6893s21c1
Sequence:CCGGGCAGCGAGGTTTAGATTATTTCTCGAGAAATAATCTAAACCTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029851.2-8849s21c1
Sequence:CCGGGAGTATCCTGCTTCGAATAAACTCGAGTTTATTCGAAGCAGGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029851.2-10506s21c1
Sequence:CCGGTCACTTAAGGAATCGTATAAACTCGAGTTTATACGATTCCTTAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-6489s1c1
Sequence:CCGGCCTCTTGAATACAGAAGTAATCTCGAGATTACTTCTGTATTCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-11517s1c1
Sequence:CCGGGCAGAAGTTCATCCCAACTTTCTCGAGAAAGTTGGGATGAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-4188s1c1
Sequence:CCGGCGCTTCAACAAAGTTGATGAACTCGAGTTCATCAACTTTGTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029851
VALIDATED
DYNC2H1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 2, heavy chain 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029851.2-13212s1c1
Sequence:CCGGGTATTTGGTGGTAGGTATTAACTCGAGTTAATACCTACCACCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-8849s1c1
Sequence:CCGGGAGTATCCTGCTTCGAATAAACTCGAGTTTATTCGAAGCAGGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029851.2-13212s21c1
Sequence:CCGGGTATTTGGTGGTAGGTATTAACTCGAGTTAATACCTACCACCAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029851.2-1754s21c1
Sequence:CCGGTGAGGCTAACAGCCGAATAATCTCGAGATTATTCGGCTGTTAGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029851.2-6893s21c1
Sequence:CCGGGCAGCGAGGTTTAGATTATTTCTCGAGAAATAATCTAAACCTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029851.2-8849s21c1
Sequence:CCGGGAGTATCCTGCTTCGAATAAACTCGAGTTTATTCGAAGCAGGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029851.2-10506s21c1
Sequence:CCGGTCACTTAAGGAATCGTATAAACTCGAGTTTATACGATTCCTTAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-6489s1c1
Sequence:CCGGCCTCTTGAATACAGAAGTAATCTCGAGATTACTTCTGTATTCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-11517s1c1
Sequence:CCGGGCAGAAGTTCATCCCAACTTTCTCGAGAAAGTTGGGATGAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029851.2-4188s1c1
Sequence:CCGGCGCTTCAACAAAGTTGATGAACTCGAGTTCATCAACTTTGTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370652
VALIDATED
DYNC2H1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 2, heavy chain 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-7681s1c1
Sequence:CCGGCGGCGCTTATTTCGTGACAAACTCGAGTTTGTCACGAAATAAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370652.2-1195s1c1
Sequence:CCGGCCTGTGCAATATAATCCATATCTCGAGATATGGATTATATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-5834s1c1
Sequence:CCGGCCCGGTTTGATGCACTGATAACTCGAGTTATCAGTGCATCAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-10585s1c1
Sequence:CCGGGCCAGCAAGATGTACTTCATTCTCGAGAATGAAGTACATCTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-3432s1c1
Sequence:CCGGCCTGGCAAGTAGTATCTCTAACTCGAGTTAGAGATACTACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370652
VALIDATED
DYNC2H1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 2, heavy chain 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-7681s1c1
Sequence:CCGGCGGCGCTTATTTCGTGACAAACTCGAGTTTGTCACGAAATAAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370652.2-1195s1c1
Sequence:CCGGCCTGTGCAATATAATCCATATCTCGAGATATGGATTATATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-5834s1c1
Sequence:CCGGCCCGGTTTGATGCACTGATAACTCGAGTTATCAGTGCATCAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-10585s1c1
Sequence:CCGGGCCAGCAAGATGTACTTCATTCTCGAGAATGAAGTACATCTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-3432s1c1
Sequence:CCGGCCTGGCAAGTAGTATCTCTAACTCGAGTTAGAGATACTACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370652
VALIDATED
DYNC2H1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 2, heavy chain 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-7681s1c1
Sequence:CCGGCGGCGCTTATTTCGTGACAAACTCGAGTTTGTCACGAAATAAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370652.2-1195s1c1
Sequence:CCGGCCTGTGCAATATAATCCATATCTCGAGATATGGATTATATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-5834s1c1
Sequence:CCGGCCCGGTTTGATGCACTGATAACTCGAGTTATCAGTGCATCAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-10585s1c1
Sequence:CCGGGCCAGCAAGATGTACTTCATTCTCGAGAATGAAGTACATCTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370652.2-3432s1c1
Sequence:CCGGCCTGGCAAGTAGTATCTCTAACTCGAGTTAGAGATACTACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks