EMAIL THIS PAGE TO A FRIEND

DYNC2LI1

dynein, cytoplasmic 2, light intermediate chain 1

Synonyms: D2LIC LIC3
Gene ID:
Mouse(213575) dynein cytoplasmic 2 light intermediate chain 1
Rat(298767) dynein cytoplasmic 2 light intermediate chain 1
Zebrafish(393452) dynein, cytoplasmic 2, light intermediate chain 1
chicken(421400) dynein, cytoplasmic 2, light intermediate chain 1
cow(507311) dynein, cytoplasmic 2, light intermediate chain 1
domestic cat(101099037) dynein, cytoplasmic 2, light intermediate chain 1
dog(474570) dynein, cytoplasmic 2, light intermediate chain 1
sheep(101114180) dynein, cytoplasmic 2, light intermediate chain 1
naked mole-rat(101722491) dynein, cytoplasmic 2, light intermediate chain 1
domestic guinea pig(100718691) dynein, cytoplasmic 2, light intermediate chain 1
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA062905 Anti-DYNC2LI1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015522 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006511 MISSION® esiRNA esiRNA targeting mouse Dync2li1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012665 Rosetta Predictions human pricing
NM_015522 Rosetta Predictions human pricing
NM_016008 Rosetta Predictions human pricing
NM_001013940 Rosetta Predictions rat pricing
NM_172256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070622 predicted 363
2 SASI_Hs01_00070624 predicted 361
3 SASI_Hs01_00070626 predicted 352
4 SASI_Hs01_00070627 predicted 269
5 SASI_Hs02_00306211 predicted 273
6 SASI_Hs01_00070628 predicted 357
7 SASI_Hs02_00306212 predicted 359
8 SASI_Hs01_00070630 predicted 238
9 SASI_Hs01_00070631 predicted 224
10 SASI_Hs02_00306213 predicted 225
11 SASI_Hs01_00070623 predicted 278
12 SASI_Hs01_00070625 predicted 280
13 SASI_Hs01_00070629 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151829 predicted 364
2 SASI_Hs01_00151831 predicted 357
3 SASI_Hs01_00151833 predicted 351
4 SASI_Hs01_00151834 predicted 270
5 SASI_Hs02_00348014 predicted 266
6 SASI_Hs01_00151835 predicted 357
7 SASI_Hs02_00348015 predicted 361
8 SASI_Hs01_00151837 predicted 238
9 SASI_Hs01_00151838 predicted 223
10 SASI_Hs02_00348016 predicted 217
11 SASI_Hs01_00151830 predicted 271
12 SASI_Hs01_00151832 predicted 272
13 SASI_Hs01_00151836 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104041 predicted 361
2 SASI_Hs01_00104043 predicted 355
3 SASI_Hs01_00104045 predicted 354
4 SASI_Hs01_00104046 predicted 272
5 SASI_Hs02_00348685 predicted 273
6 SASI_Hs01_00104047 predicted 355
7 SASI_Hs02_00348686 predicted 358
8 SASI_Hs01_00104049 predicted 233
9 SASI_Hs01_00104050 predicted 227
10 SASI_Hs02_00348687 predicted 223
11 SASI_Hs01_00104042 predicted 272
12 SASI_Hs01_00104044 predicted 282
13 SASI_Hs01_00104048 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201249 predicted 802
2 SASI_Rn01_00061143 predicted 202
3 SASI_Rn02_00201250 predicted 1023
4 SASI_Rn01_00061145 predicted 1067
5 SASI_Rn01_00061146 predicted 1066
6 SASI_Rn01_00061147 predicted 678
7 SASI_Rn01_00061148 predicted 744
8 SASI_Rn01_00061149 predicted 972
9 SASI_Rn01_00061150 predicted 926
10 SASI_Rn02_00201251 predicted 1009
11 SASI_Rn01_00061142 predicted 385
12 SASI_Rn01_00061144 predicted 1026
13 SASI_Rn01_00061151 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069902 predicted 924
2 SASI_Mm01_00069903 predicted 204
3 SASI_Mm01_00069904 predicted 588
4 SASI_Mm01_00069905 predicted 364
5 SASI_Mm02_00343721 predicted 593
6 SASI_Mm01_00069906 predicted 1075
7 SASI_Mm01_00069907 predicted 1017
8 SASI_Mm01_00069908 predicted 861
9 SASI_Mm01_00069909 predicted 555
10 SASI_Mm01_00069910 predicted 743
11 SASI_Mm01_00069911 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172256
DYNC2LI1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 2, light intermediate chain 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183244    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172256.1-1212s1c1
Sequence:CCGGGTGAAGAAAGTTGAGCGTATACTCGAGTATACGCTCAACTTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172256.1-1072s1c1
Sequence:CCGGCCAGGAACTAGAACACTACAACTCGAGTTGTAGTGTTCTAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172256.1-489s1c1
Sequence:CCGGGCCATGTAGACAAGGTGATAACTCGAGTTATCACCTTGTCTACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-389s21c1
Sequence:CCGGGTCGACACCTTAAGGACATTTCTCGAGAAATGTCCTTAAGGTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172256.1-1170s21c1
Sequence:CCGGCCCAATCGAGGAAGATTATTTCTCGAGAAATAATCTTCCTCGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-613s21c1
Sequence:CCGGTCCAATACCTCTGGTCATTATCTCGAGATAATGACCAGAGGTATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-698s21c1
Sequence:CCGGCTGCGCTTTGTGGCACATTACCTCGAGGTAATGTGCCACAAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-582s21c1
Sequence:CCGGACCATCCGGACCGGGAATTAACTCGAGTTAATTCCCGGTCCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172256
DYNC2LI1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 2, light intermediate chain 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183244    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172256.1-1212s1c1
Sequence:CCGGGTGAAGAAAGTTGAGCGTATACTCGAGTATACGCTCAACTTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172256.1-1072s1c1
Sequence:CCGGCCAGGAACTAGAACACTACAACTCGAGTTGTAGTGTTCTAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172256.1-489s1c1
Sequence:CCGGGCCATGTAGACAAGGTGATAACTCGAGTTATCACCTTGTCTACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-389s21c1
Sequence:CCGGGTCGACACCTTAAGGACATTTCTCGAGAAATGTCCTTAAGGTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172256.1-1170s21c1
Sequence:CCGGCCCAATCGAGGAAGATTATTTCTCGAGAAATAATCTTCCTCGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-613s21c1
Sequence:CCGGTCCAATACCTCTGGTCATTATCTCGAGATAATGACCAGAGGTATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-698s21c1
Sequence:CCGGCTGCGCTTTGTGGCACATTACCTCGAGGTAATGTGCCACAAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-582s21c1
Sequence:CCGGACCATCCGGACCGGGAATTAACTCGAGTTAATTCCCGGTCCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172256
DYNC2LI1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 2, light intermediate chain 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183244    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172256.1-1212s1c1
Sequence:CCGGGTGAAGAAAGTTGAGCGTATACTCGAGTATACGCTCAACTTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172256.1-1072s1c1
Sequence:CCGGCCAGGAACTAGAACACTACAACTCGAGTTGTAGTGTTCTAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172256.1-489s1c1
Sequence:CCGGGCCATGTAGACAAGGTGATAACTCGAGTTATCACCTTGTCTACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-389s21c1
Sequence:CCGGGTCGACACCTTAAGGACATTTCTCGAGAAATGTCCTTAAGGTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172256.1-1170s21c1
Sequence:CCGGCCCAATCGAGGAAGATTATTTCTCGAGAAATAATCTTCCTCGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-613s21c1
Sequence:CCGGTCCAATACCTCTGGTCATTATCTCGAGATAATGACCAGAGGTATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-698s21c1
Sequence:CCGGCTGCGCTTTGTGGCACATTACCTCGAGGTAATGTGCCACAAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172256.1-582s21c1
Sequence:CCGGACCATCCGGACCGGGAATTAACTCGAGTTAATTCCCGGTCCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015522
VALIDATED
DYNC2LI1 MISSION shRNA Bacterial Glycerol Stock
dynein, cytoplasmic 2, light intermediate chain 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122026    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015522.2-824s1c1
Sequence:CCGGGTTATGGCATATTACACCAATCTCGAGATTGGTGTAATATGCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015522.2-365s1c1
Sequence:CCGGGAACCTCTTTATTGGACTTAACTCGAGTTAAGTCCAATAAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015522.2-430s1c1
Sequence:CCGGGTTCTCGTTCTGGATCTTTCACTCGAGTGAAAGATCCAGAACGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015522.2-169s1c1
Sequence:CCGGGATGGAGCTGAAATTGCAGAACTCGAGTTCTGCAATTTCAGCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015522.2-938s1c1
Sequence:CCGGGACAAAGACTAGATGAAGCTACTCGAGTAGCTTCATCTAGTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015522.2-274s1c1
Sequence:CCGGCCAACCTTAGCTTTGGAATATCTCGAGATATTCCAAAGCTAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015522.2-579s1c1
Sequence:CCGGGAATAATATGCCGAAGGATCACTCGAGTGATCCTTCGGCATATTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015522.2-991s1c1
Sequence:CCGGCTTCACCATCACTCTGTATTTCTCGAGAAATACAGAGTGATGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-169s21c1
Sequence:CCGGGATGGAGCTGAAATTGCAGAACTCGAGTTCTGCAATTTCAGCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015522.2-630s1c1
Sequence:CCGGGGAATCCTTAGTCCCATTTATCTCGAGATAAATGGGACTAAGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015522.2-505s1c1
Sequence:CCGGCATGTAGACAAAGTGATAATGCTCGAGCATTATCACTTTGTCTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-430s21c1
Sequence:CCGGGTTCTCGTTCTGGATCTTTCACTCGAGTGAAAGATCCAGAACGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-505s21c1
Sequence:CCGGCATGTAGACAAAGTGATAATGCTCGAGCATTATCACTTTGTCTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-274s21c1
Sequence:CCGGCCAACCTTAGCTTTGGAATATCTCGAGATATTCCAAAGCTAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015522
VALIDATED
DYNC2LI1 MISSION shRNA shRNA Plasmid DNA
dynein, cytoplasmic 2, light intermediate chain 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122026    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015522.2-824s1c1
Sequence:CCGGGTTATGGCATATTACACCAATCTCGAGATTGGTGTAATATGCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015522.2-365s1c1
Sequence:CCGGGAACCTCTTTATTGGACTTAACTCGAGTTAAGTCCAATAAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015522.2-430s1c1
Sequence:CCGGGTTCTCGTTCTGGATCTTTCACTCGAGTGAAAGATCCAGAACGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015522.2-169s1c1
Sequence:CCGGGATGGAGCTGAAATTGCAGAACTCGAGTTCTGCAATTTCAGCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015522.2-938s1c1
Sequence:CCGGGACAAAGACTAGATGAAGCTACTCGAGTAGCTTCATCTAGTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015522.2-274s1c1
Sequence:CCGGCCAACCTTAGCTTTGGAATATCTCGAGATATTCCAAAGCTAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015522.2-579s1c1
Sequence:CCGGGAATAATATGCCGAAGGATCACTCGAGTGATCCTTCGGCATATTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015522.2-991s1c1
Sequence:CCGGCTTCACCATCACTCTGTATTTCTCGAGAAATACAGAGTGATGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-169s21c1
Sequence:CCGGGATGGAGCTGAAATTGCAGAACTCGAGTTCTGCAATTTCAGCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015522.2-630s1c1
Sequence:CCGGGGAATCCTTAGTCCCATTTATCTCGAGATAAATGGGACTAAGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015522.2-505s1c1
Sequence:CCGGCATGTAGACAAAGTGATAATGCTCGAGCATTATCACTTTGTCTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-430s21c1
Sequence:CCGGGTTCTCGTTCTGGATCTTTCACTCGAGTGAAAGATCCAGAACGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-505s21c1
Sequence:CCGGCATGTAGACAAAGTGATAATGCTCGAGCATTATCACTTTGTCTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-274s21c1
Sequence:CCGGCCAACCTTAGCTTTGGAATATCTCGAGATATTCCAAAGCTAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015522
VALIDATED
DYNC2LI1 MISSION shRNA Lentiviral Transduction Particles
dynein, cytoplasmic 2, light intermediate chain 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122026    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015522.2-824s1c1
Sequence:CCGGGTTATGGCATATTACACCAATCTCGAGATTGGTGTAATATGCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015522.2-365s1c1
Sequence:CCGGGAACCTCTTTATTGGACTTAACTCGAGTTAAGTCCAATAAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015522.2-430s1c1
Sequence:CCGGGTTCTCGTTCTGGATCTTTCACTCGAGTGAAAGATCCAGAACGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015522.2-169s1c1
Sequence:CCGGGATGGAGCTGAAATTGCAGAACTCGAGTTCTGCAATTTCAGCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015522.2-938s1c1
Sequence:CCGGGACAAAGACTAGATGAAGCTACTCGAGTAGCTTCATCTAGTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015522.2-274s1c1
Sequence:CCGGCCAACCTTAGCTTTGGAATATCTCGAGATATTCCAAAGCTAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015522.2-579s1c1
Sequence:CCGGGAATAATATGCCGAAGGATCACTCGAGTGATCCTTCGGCATATTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015522.2-991s1c1
Sequence:CCGGCTTCACCATCACTCTGTATTTCTCGAGAAATACAGAGTGATGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-169s21c1
Sequence:CCGGGATGGAGCTGAAATTGCAGAACTCGAGTTCTGCAATTTCAGCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015522.2-630s1c1
Sequence:CCGGGGAATCCTTAGTCCCATTTATCTCGAGATAAATGGGACTAAGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015522.2-505s1c1
Sequence:CCGGCATGTAGACAAAGTGATAATGCTCGAGCATTATCACTTTGTCTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-430s21c1
Sequence:CCGGGTTCTCGTTCTGGATCTTTCACTCGAGTGAAAGATCCAGAACGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-505s21c1
Sequence:CCGGCATGTAGACAAAGTGATAATGCTCGAGCATTATCACTTTGTCTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015522.2-274s21c1
Sequence:CCGGCCAACCTTAGCTTTGGAATATCTCGAGATATTCCAAAGCTAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks