EMAIL THIS PAGE TO A FRIEND

DYNLL1

dynein, light chain, LC8-type 1

98 Gene Product Result for
Synonyms: DLC1 DLC8 DNCL1 DNCLC1 LC8 LC8a PIN hdlc1
UniProtKB ID: P63167, Q15701
Gene ID:
Human(8655) Summary: Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Mouse(56455) dynein light chain LC8-type 1
Rat(58945) dynein light chain LC8-type 1
domestic guinea pig(100721653) dynein, light chain, LC8-type 1
naked mole-rat(101696473) dynein, light chain, LC8-type 1
sheep(101118902) dynein, light chain, LC8-type 1
Domestic Rabbit(100008650) dynein, light chain, LC8-type 1
Zebrafish(406297) dynein, light chain, LC8-type 1
cow(404151) dynein, light chain, LC8-type 1
domestic cat(101096515) dynein, light chain, LC8-type 1
chicken(100859081) dynein light chain 1, cytoplasmic-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108272 Anti-DYNLL1 antibody produced in rabbit affinity isolated antibody guinea pig, canine, rabbit, mouse, horse, rat, human, bovine
western blot pricing
SAB2103203 Anti-DYNLL1 antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, chicken, rabbit, mouse, canine, rat, human, bovine, horse,
western blot pricing
HPA039954 Anti-DYNLL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2103204 Anti-DYNLL1, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, rabbit, mouse, guinea pig, horse, human, rabbit, zebrafish, canine, rat
western blot pricing
SAB1402996 Monoclonal Anti-DYNLL1, (N-terminal) antibody produced in mouse clone 1H7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003746 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037494 Rosetta Predictions human pricing
NM_001037495 Rosetta Predictions human pricing
NM_003746 Rosetta Predictions human pricing
NM_053319 Rosetta Predictions rat pricing
NM_019682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308298 predicted 544
2 SASI_Hs02_00308299 predicted 531
3 SASI_Hs01_00185904 predicted 485
4 SASI_Hs02_00308300 predicted 488
5 SASI_Hs01_00185906 predicted 566
6 SASI_Hs01_00185907 predicted 481
7 SASI_Hs01_00185908 predicted 568
8 SASI_Hs01_00185909 predicted 449
9 SASI_Hs01_00185910 predicted 453
10 SASI_Hs01_00185911 predicted 484
11 SASI_Hs01_00185905 predicted 495
12 SASI_Hs01_00185912 predicted 492
13 SASI_Hs01_00185913 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308301 predicted 467
2 SASI_Hs02_00308302 predicted 450
3 SASI_Hs01_00054322 predicted 408
4 SASI_Hs02_00308303 predicted 415
5 SASI_Hs01_00054324 predicted 494
6 SASI_Hs01_00054325 predicted 413
7 SASI_Hs01_00054326 predicted 503
8 SASI_Hs01_00054327 predicted 375
9 SASI_Hs01_00054328 predicted 382
10 SASI_Hs01_00054329 predicted 416
11 SASI_Hs01_00054323 predicted 424
12 SASI_Hs01_00054330 predicted 420
13 SASI_Hs01_00054331 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336208 predicted 456
2 SASI_Hs02_00336209 predicted 444
3 SASI_Hs01_00111618 predicted 402
4 SASI_Hs02_00336210 predicted 398
5 SASI_Hs01_00111620 predicted 475
6 SASI_Hs01_00111621 predicted 399
7 SASI_Hs01_00111622 predicted 482
8 SASI_Hs01_00111623 predicted 357
9 SASI_Hs01_00111624 predicted 367
10 SASI_Hs01_00111625 predicted 400
11 SASI_Hs01_00111619 predicted 414
12 SASI_Hs01_00111626 predicted 411
13 SASI_Hs01_00111627 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080459 predicted 361
2 SASI_Rn01_00080460 predicted 362
3 SASI_Rn01_00080461 predicted 292
4 SASI_Rn01_00080462 predicted 212
5 SASI_Rn01_00080463 predicted 348
6 SASI_Rn01_00080464 predicted 355
7 SASI_Rn01_00080465 predicted 213
8 SASI_Rn01_00080466 predicted 227
9 SASI_Rn01_00080467 predicted 211
10 SASI_Rn01_00080468 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324759 predicted 284
2 SASI_Mm01_00095171 predicted 283
3 SASI_Mm01_00095172 predicted 294
4 SASI_Mm01_00095173 predicted 287
5 SASI_Mm02_00324760 predicted 197
6 SASI_Mm02_00324761 predicted 426
7 SASI_Mm02_00324762 predicted 426
8 SASI_Mm02_00324763 predicted 611
9 SASI_Mm02_00324764 predicted 607
10 SASI_Mm02_00324765 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003746
VALIDATED
DYNLL1 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, LC8-type 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-499s21c1
Sequence:CCGGCCAAATACCAGAGACTGAAATCTCGAGATTTCAGTCTCTGGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-300s21c1
Sequence:CCGGGAATTTGACAAGAAGTACAATCTCGAGATTGTACTTCTTGTCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-314s21c1
Sequence:CCGGGTACAATCCCACCTGGCATTGCTCGAGCAATGCCAGGTGGGATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-271s21c1
Sequence:CCGGAGAAGGACATTGCGGCTCATACTCGAGTATGAGCCGCAATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-478s21c1
Sequence:CCGGACAAGGACTGCAGCCTAAATTCTCGAGAATTTAGGCTGCAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-409s21c1
Sequence:CCGGTGGCCATTCTTCTGTTCAAATCTCGAGATTTGAACAGAAGAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-375s21c1
Sequence:CCGGACCAAACACTTCATCTACTTCCTCGAGGAAGTAGATGAAGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-342s21c1
Sequence:CCGGGGGAGGAACTTCGGTAGTTATCTCGAGATAACTACCGAAGTTCCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003746.1-342s1c1
Sequence:CCGGTCTTCTGTTCAAATCTGGTTACTCGAGTAACCAGATTTGAACAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003746.1-279s1c1
Sequence:CCGGCGGTAGTTATGTGACACATGACTCGAGTCATGTGTCACATAACTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003746.1-175s1c1
Sequence:CCGGGCGCTGGAGAAATACAACATACTCGAGTATGTTGTATTTCTCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003746.1-334s1c1
Sequence:CCGGGTGGCCATTCTTCTGTTCAAACTCGAGTTTGAACAGAAGAATGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003746.1-197s1c1
Sequence:CCGGAGAAGGACATTGCGGCTCATACTCGAGTATGAGCCGCAATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003746
VALIDATED
DYNLL1 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, LC8-type 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-499s21c1
Sequence:CCGGCCAAATACCAGAGACTGAAATCTCGAGATTTCAGTCTCTGGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-300s21c1
Sequence:CCGGGAATTTGACAAGAAGTACAATCTCGAGATTGTACTTCTTGTCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-314s21c1
Sequence:CCGGGTACAATCCCACCTGGCATTGCTCGAGCAATGCCAGGTGGGATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-271s21c1
Sequence:CCGGAGAAGGACATTGCGGCTCATACTCGAGTATGAGCCGCAATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-478s21c1
Sequence:CCGGACAAGGACTGCAGCCTAAATTCTCGAGAATTTAGGCTGCAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-409s21c1
Sequence:CCGGTGGCCATTCTTCTGTTCAAATCTCGAGATTTGAACAGAAGAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-375s21c1
Sequence:CCGGACCAAACACTTCATCTACTTCCTCGAGGAAGTAGATGAAGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-342s21c1
Sequence:CCGGGGGAGGAACTTCGGTAGTTATCTCGAGATAACTACCGAAGTTCCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003746.1-342s1c1
Sequence:CCGGTCTTCTGTTCAAATCTGGTTACTCGAGTAACCAGATTTGAACAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003746.1-279s1c1
Sequence:CCGGCGGTAGTTATGTGACACATGACTCGAGTCATGTGTCACATAACTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003746.1-175s1c1
Sequence:CCGGGCGCTGGAGAAATACAACATACTCGAGTATGTTGTATTTCTCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003746.1-334s1c1
Sequence:CCGGGTGGCCATTCTTCTGTTCAAACTCGAGTTTGAACAGAAGAATGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003746.1-197s1c1
Sequence:CCGGAGAAGGACATTGCGGCTCATACTCGAGTATGAGCCGCAATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003746
VALIDATED
DYNLL1 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, LC8-type 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-499s21c1
Sequence:CCGGCCAAATACCAGAGACTGAAATCTCGAGATTTCAGTCTCTGGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-300s21c1
Sequence:CCGGGAATTTGACAAGAAGTACAATCTCGAGATTGTACTTCTTGTCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-314s21c1
Sequence:CCGGGTACAATCCCACCTGGCATTGCTCGAGCAATGCCAGGTGGGATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-271s21c1
Sequence:CCGGAGAAGGACATTGCGGCTCATACTCGAGTATGAGCCGCAATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-478s21c1
Sequence:CCGGACAAGGACTGCAGCCTAAATTCTCGAGAATTTAGGCTGCAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-409s21c1
Sequence:CCGGTGGCCATTCTTCTGTTCAAATCTCGAGATTTGAACAGAAGAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-375s21c1
Sequence:CCGGACCAAACACTTCATCTACTTCCTCGAGGAAGTAGATGAAGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003746.2-342s21c1
Sequence:CCGGGGGAGGAACTTCGGTAGTTATCTCGAGATAACTACCGAAGTTCCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003746.1-342s1c1
Sequence:CCGGTCTTCTGTTCAAATCTGGTTACTCGAGTAACCAGATTTGAACAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003746.1-279s1c1
Sequence:CCGGCGGTAGTTATGTGACACATGACTCGAGTCATGTGTCACATAACTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003746.1-175s1c1
Sequence:CCGGGCGCTGGAGAAATACAACATACTCGAGTATGTTGTATTTCTCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003746.1-334s1c1
Sequence:CCGGGTGGCCATTCTTCTGTTCAAACTCGAGTTTGAACAGAAGAATGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003746.1-197s1c1
Sequence:CCGGAGAAGGACATTGCGGCTCATACTCGAGTATGAGCCGCAATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019682
VALIDATED
DYNLL1 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, LC8-type 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-510s21c1
Sequence:CCGGCTGAATCTTCAGCCTTGCTAACTCGAGTTAGCAAGGCTGAAGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-366s21c1
Sequence:CCGGACATGAAACCAAACACTTCATCTCGAGATGAAGTGTTTGGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019682.4-790s21c1
Sequence:CCGGCTGTTCTGTAGGATTAGTTTACTCGAGTAAACTAATCCTACAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-283s21c1
Sequence:CCGGGCCCATATCAAGAAGGAGTTTCTCGAGAAACTCCTTCTTGATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-247s21c1
Sequence:CCGGGCGTTGGAGAAGTACAACATCCTCGAGGATGTTGTACTTCTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019682.2-457s1c1
Sequence:CCGGCTGAATCTTCAGCCTTGCTAACTCGAGTTAGCAAGGCTGAAGATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019682.2-298s1c1
Sequence:CCGGCGGTAGTTATGTGGCACATGACTCGAGTCATGTGCCACATAACTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019682.2-313s1c1
Sequence:CCGGACATGAAACCAAACACTTCATCTCGAGATGAAGTGTTTGGTTTCATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019682.2-194s1c1
Sequence:CCGGGCGTTGGAGAAGTACAACATCCTCGAGGATGTTGTACTTCTCCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019682.2-230s1c1
Sequence:CCGGGCCCATATCAAGAAGGAGTTTCTCGAGAAACTCCTTCTTGATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019682
VALIDATED
DYNLL1 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, LC8-type 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-510s21c1
Sequence:CCGGCTGAATCTTCAGCCTTGCTAACTCGAGTTAGCAAGGCTGAAGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-366s21c1
Sequence:CCGGACATGAAACCAAACACTTCATCTCGAGATGAAGTGTTTGGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019682.4-790s21c1
Sequence:CCGGCTGTTCTGTAGGATTAGTTTACTCGAGTAAACTAATCCTACAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-283s21c1
Sequence:CCGGGCCCATATCAAGAAGGAGTTTCTCGAGAAACTCCTTCTTGATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-247s21c1
Sequence:CCGGGCGTTGGAGAAGTACAACATCCTCGAGGATGTTGTACTTCTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019682.2-457s1c1
Sequence:CCGGCTGAATCTTCAGCCTTGCTAACTCGAGTTAGCAAGGCTGAAGATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019682.2-298s1c1
Sequence:CCGGCGGTAGTTATGTGGCACATGACTCGAGTCATGTGCCACATAACTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019682.2-313s1c1
Sequence:CCGGACATGAAACCAAACACTTCATCTCGAGATGAAGTGTTTGGTTTCATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019682.2-194s1c1
Sequence:CCGGGCGTTGGAGAAGTACAACATCCTCGAGGATGTTGTACTTCTCCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019682.2-230s1c1
Sequence:CCGGGCCCATATCAAGAAGGAGTTTCTCGAGAAACTCCTTCTTGATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019682
VALIDATED
DYNLL1 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, LC8-type 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-510s21c1
Sequence:CCGGCTGAATCTTCAGCCTTGCTAACTCGAGTTAGCAAGGCTGAAGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-366s21c1
Sequence:CCGGACATGAAACCAAACACTTCATCTCGAGATGAAGTGTTTGGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019682.4-790s21c1
Sequence:CCGGCTGTTCTGTAGGATTAGTTTACTCGAGTAAACTAATCCTACAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-283s21c1
Sequence:CCGGGCCCATATCAAGAAGGAGTTTCTCGAGAAACTCCTTCTTGATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019682.4-247s21c1
Sequence:CCGGGCGTTGGAGAAGTACAACATCCTCGAGGATGTTGTACTTCTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019682.2-457s1c1
Sequence:CCGGCTGAATCTTCAGCCTTGCTAACTCGAGTTAGCAAGGCTGAAGATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019682.2-298s1c1
Sequence:CCGGCGGTAGTTATGTGGCACATGACTCGAGTCATGTGCCACATAACTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019682.2-313s1c1
Sequence:CCGGACATGAAACCAAACACTTCATCTCGAGATGAAGTGTTTGGTTTCATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019682.2-194s1c1
Sequence:CCGGGCGTTGGAGAAGTACAACATCCTCGAGGATGTTGTACTTCTCCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019682.2-230s1c1
Sequence:CCGGGCCCATATCAAGAAGGAGTTTCTCGAGAAACTCCTTCTTGATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks