EMAIL THIS PAGE TO A FRIEND

DYNLL2

dynein, light chain, LC8-type 2

Synonyms: DNCL1B Dlc2 RSPH22
UniProtKB ID: Q96FJ2, B2R5B4
Gene ID:
Mouse(68097) dynein light chain LC8-type 2
Rat(140734) dynein light chain LC8-type 2
chicken(417663) dynein, light chain, LC8-type 2
cow(540369) dynein, light chain, LC8-type 2
domestic cat(101098906) dynein, light chain, LC8-type 2
dog(480569) dynein, light chain, LC8-type 2
Goat(100861139) dynein, light chain, LC8-type 2
sheep(101121274) dynein, light chain, LC8-type 2
naked mole-rat(101716095) dynein, light chain, LC8-type 2
domestic guinea pig(100721508) dynein, light chain, LC8-type 2
Gene Class: Cytoskeleton
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV52514 Anti-DYNLL2 antibody produced in rabbit affinity isolated antibody human, zebrafish, rat, Caenorhabditis elegans, canine, mouse, guinea pig, horse, rabbit
western blot pricing
SAB4500480 Anti-DYNLL2, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB1402007 Monoclonal Anti-DYNLL2 antibody produced in mouse clone 1G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080677 Rosetta Predictions human pricing
NM_080697 Rosetta Predictions rat pricing
NM_026556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244404 predicted 424
2 SASI_Hs01_00244405 predicted 450
3 SASI_Hs02_00362452 predicted 372
4 SASI_Hs01_00244407 predicted 468
5 SASI_Hs02_00362453 predicted 378
6 SASI_Hs01_00244408 predicted 291
7 SASI_Hs01_00244409 predicted 367
8 SASI_Hs02_00362454 predicted 393
9 SASI_Hs01_00244410 predicted 366
10 SASI_Hs01_00244412 predicted 302
11 SASI_Hs01_00244406 predicted 349
12 SASI_Hs01_00244411 predicted 343
13 SASI_Hs01_00244413 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115927 predicted 419
2 SASI_Rn01_00115928 predicted 810
3 SASI_Rn01_00115929 predicted 760
4 SASI_Rn01_00115930 predicted 832
5 SASI_Rn01_00115931 predicted 641
6 SASI_Rn01_00115932 predicted 456
7 SASI_Rn01_00115933 predicted 999
8 SASI_Rn01_00115934 predicted 1018
9 SASI_Rn01_00115936 predicted 627
10 SASI_Rn02_00267285 predicted 730
11 SASI_Rn01_00115935 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189156 predicted 474
2 SASI_Mm01_00189157 predicted 680
3 SASI_Mm01_00189158 predicted 449
4 SASI_Mm01_00189159 predicted 654
5 SASI_Mm01_00189160 predicted 774
6 SASI_Mm01_00189161 predicted 655
7 SASI_Mm01_00189162 predicted 376
8 SASI_Mm01_00189163 predicted 429
9 SASI_Mm01_00189164 predicted 285
10 SASI_Mm01_00189165 predicted 639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026556
VALIDATED
DYNLL2 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, LC8-type 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-463s1c1
Sequence:CCGGGCTATGTCACACACGAGACAACTCGAGTTGTCTCGTGTGTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-306s1c1
Sequence:CCGGGACATGTCTGAGGACATGCAACTCGAGTTGCATGTCCTCAGACATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-377s1c1
Sequence:CCGGGAAGGACATTGCTGCCTATATCTCGAGATATAGGCAGCAATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-390s1c1
Sequence:CCGGGCCTATATCAAGAAGGAATTTCTCGAGAAATTCCTTCTTGATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-376s21c1
Sequence:CCGGGAAGGACATTGCTGCCTATATCTCGAGATATAGGCAGCAATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-462s21c1
Sequence:CCGGGCTATGTCACACACGAGACAACTCGAGTTGTCTCGTGTGTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-389s21c1
Sequence:CCGGGCCTATATCAAGAAGGAATTTCTCGAGAAATTCCTTCTTGATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-305s21c1
Sequence:CCGGGACATGTCTGAGGACATGCAACTCGAGTTGCATGTCCTCAGACATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026556
VALIDATED
DYNLL2 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, LC8-type 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-463s1c1
Sequence:CCGGGCTATGTCACACACGAGACAACTCGAGTTGTCTCGTGTGTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-306s1c1
Sequence:CCGGGACATGTCTGAGGACATGCAACTCGAGTTGCATGTCCTCAGACATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-377s1c1
Sequence:CCGGGAAGGACATTGCTGCCTATATCTCGAGATATAGGCAGCAATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-390s1c1
Sequence:CCGGGCCTATATCAAGAAGGAATTTCTCGAGAAATTCCTTCTTGATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-376s21c1
Sequence:CCGGGAAGGACATTGCTGCCTATATCTCGAGATATAGGCAGCAATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-462s21c1
Sequence:CCGGGCTATGTCACACACGAGACAACTCGAGTTGTCTCGTGTGTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-389s21c1
Sequence:CCGGGCCTATATCAAGAAGGAATTTCTCGAGAAATTCCTTCTTGATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-305s21c1
Sequence:CCGGGACATGTCTGAGGACATGCAACTCGAGTTGCATGTCCTCAGACATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026556
VALIDATED
DYNLL2 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, LC8-type 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-463s1c1
Sequence:CCGGGCTATGTCACACACGAGACAACTCGAGTTGTCTCGTGTGTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-306s1c1
Sequence:CCGGGACATGTCTGAGGACATGCAACTCGAGTTGCATGTCCTCAGACATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-377s1c1
Sequence:CCGGGAAGGACATTGCTGCCTATATCTCGAGATATAGGCAGCAATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026556.2-390s1c1
Sequence:CCGGGCCTATATCAAGAAGGAATTTCTCGAGAAATTCCTTCTTGATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-376s21c1
Sequence:CCGGGAAGGACATTGCTGCCTATATCTCGAGATATAGGCAGCAATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-462s21c1
Sequence:CCGGGCTATGTCACACACGAGACAACTCGAGTTGTCTCGTGTGTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-389s21c1
Sequence:CCGGGCCTATATCAAGAAGGAATTTCTCGAGAAATTCCTTCTTGATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026556.3-305s21c1
Sequence:CCGGGACATGTCTGAGGACATGCAACTCGAGTTGCATGTCCTCAGACATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080677
DYNLL2 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, LC8-type 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080677.1-581s1c1
Sequence:CCGGGCGGCGTTGCTGGGACTGTTTCTCGAGAAACAGTCCCAGCAACGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-379s1c1
Sequence:CCGGCTGCCTATATCAAGAAGGAATCTCGAGATTCCTTCTTGATATAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-345s1c1
Sequence:CCGGGCCATGGAGAAGTACAATATACTCGAGTATATTGTACTTCTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-470s1c1
Sequence:CCGGGACAAAGCACTTCATCTATTTCTCGAGAAATAGATGAAGTGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-426s1c1
Sequence:CCGGCATTGTATCGTGGGCCGAAATCTCGAGATTTCGGCCCACGATACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080677.2-323s21c1
Sequence:CCGGATGCAACAGGATGCCGTTGACCTCGAGGTCAACGGCATCCTGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080677.2-740s21c1
Sequence:CCGGGAAGGCTGCTTTATGTTTATTCTCGAGAATAAACATAAAGCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080677.2-995s21c1
Sequence:CCGGGGACAGTGTTGGGATTGTCAACTCGAGTTGACAATCCCAACACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080677
DYNLL2 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, LC8-type 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080677.1-581s1c1
Sequence:CCGGGCGGCGTTGCTGGGACTGTTTCTCGAGAAACAGTCCCAGCAACGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-379s1c1
Sequence:CCGGCTGCCTATATCAAGAAGGAATCTCGAGATTCCTTCTTGATATAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-345s1c1
Sequence:CCGGGCCATGGAGAAGTACAATATACTCGAGTATATTGTACTTCTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-470s1c1
Sequence:CCGGGACAAAGCACTTCATCTATTTCTCGAGAAATAGATGAAGTGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-426s1c1
Sequence:CCGGCATTGTATCGTGGGCCGAAATCTCGAGATTTCGGCCCACGATACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080677.2-323s21c1
Sequence:CCGGATGCAACAGGATGCCGTTGACCTCGAGGTCAACGGCATCCTGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080677.2-740s21c1
Sequence:CCGGGAAGGCTGCTTTATGTTTATTCTCGAGAATAAACATAAAGCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080677.2-995s21c1
Sequence:CCGGGGACAGTGTTGGGATTGTCAACTCGAGTTGACAATCCCAACACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080677
DYNLL2 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, LC8-type 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080677.1-581s1c1
Sequence:CCGGGCGGCGTTGCTGGGACTGTTTCTCGAGAAACAGTCCCAGCAACGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-379s1c1
Sequence:CCGGCTGCCTATATCAAGAAGGAATCTCGAGATTCCTTCTTGATATAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-345s1c1
Sequence:CCGGGCCATGGAGAAGTACAATATACTCGAGTATATTGTACTTCTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-470s1c1
Sequence:CCGGGACAAAGCACTTCATCTATTTCTCGAGAAATAGATGAAGTGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080677.1-426s1c1
Sequence:CCGGCATTGTATCGTGGGCCGAAATCTCGAGATTTCGGCCCACGATACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080677.2-323s21c1
Sequence:CCGGATGCAACAGGATGCCGTTGACCTCGAGGTCAACGGCATCCTGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080677.2-740s21c1
Sequence:CCGGGAAGGCTGCTTTATGTTTATTCTCGAGAATAAACATAAAGCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080677.2-995s21c1
Sequence:CCGGGGACAGTGTTGGGATTGTCAACTCGAGTTGACAATCCCAACACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks