EMAIL THIS PAGE TO A FRIEND

DYNLRB1

dynein, light chain, roadblock-type 1

56 Gene Product Result for
Synonyms: BITH BLP DNCL2A DNLC2A ROBLD1
UniProtKB ID: Q9NP97, B1AKR5, Q5TC72, Q96IV3, Q9NQM2
Gene ID:
Human(83658) Summary: This gene is a member of the roadblock dynein light chain family and encodes a cytoplasmic protein that is capable of binding intermediate chain proteins. Upregulation of this gene has been associated with hepatocellular carcinomas, suggesting that this gene may be involved in tumor progression. [provided by RefSeq, Jul 2008]
Mouse(67068) dynein light chain roadblock-type 1
Rat(170714) dynein light chain roadblock-type 1
Zebrafish(394163) dynein, light chain, roadblock-type 1
dog(477200) dynein, light chain, roadblock-type 1
chicken(419143) dynein, light chain, roadblock-type 1
cow(513342) dynein, light chain, roadblock-type 1
domestic cat(101085876) dynein, light chain, roadblock-type 1
domestic guinea pig(100725912) dynein, light chain, roadblock-type 1
sheep(101112751) dynein, light chain, roadblock-type 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014183 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014183 Rosetta Predictions human pricing
NM_131910 Rosetta Predictions rat pricing
NM_025947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158744 predicted 321
2 SASI_Hs01_00158745 predicted 303
3 SASI_Hs02_00345212 predicted 256
4 SASI_Hs01_00158746 predicted 363
5 SASI_Hs01_00158748 predicted 389
6 SASI_Hs01_00158749 predicted 297
7 SASI_Hs01_00158750 predicted 393
8 SASI_Hs01_00158751 predicted 283
9 SASI_Hs01_00158752 predicted 340
10 SASI_Hs01_00158753 predicted 444
11 SASI_Hs01_00158747 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058198 predicted 368
2 SASI_Rn01_00058200 predicted 384
3 SASI_Rn01_00058201 predicted 301
4 SASI_Rn01_00058202 predicted 421
5 SASI_Rn02_00267538 predicted 355
6 SASI_Rn01_00058203 predicted 246
7 SASI_Rn02_00267539 predicted 373
8 SASI_Rn01_00058204 predicted 241
9 SASI_Rn01_00058205 predicted 422
10 SASI_Rn01_00058206 predicted 425
11 SASI_Rn01_00058199 predicted 325
12 SASI_Rn01_00058207 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079929 predicted 231
2 SASI_Mm01_00079930 predicted 277
3 SASI_Mm01_00079931 predicted 379
4 SASI_Mm01_00079933 predicted 195
5 SASI_Mm01_00079935 predicted 377
6 SASI_Mm01_00079937 predicted 350
7 SASI_Mm01_00079938 predicted 295
8 SASI_Mm02_00329341 predicted 269
9 SASI_Mm02_00329342 predicted 237
10 SASI_Mm02_00329343 predicted 233
11 SASI_Mm01_00079932 predicted 351
12 SASI_Mm01_00079934 predicted 303
13 SASI_Mm01_00079936 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025947
VALIDATED
DYNLRB1 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, roadblock-type 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025947.3-421s21c1
Sequence:CCGGAGAATAATAGTGCTAATCATGCTCGAGCATGATTAGCACTATTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025947.2-311s1c1
Sequence:CCGGGTGATCCAGAATCCAACTGAACTCGAGTTCAGTTGGATTCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-314s21c1
Sequence:CCGGATCCAGAATCCAACTGAATAACTCGAGTTATTCAGTTGGATTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-170s21c1
Sequence:CCGGGCCAACCTCATGCACAACTTCCTCGAGGAAGTTGTGCATGAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-275s21c1
Sequence:CCGGATTATGGTGGCACCAGATAAACTCGAGTTTATCTGGTGCCACCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-351s21c1
Sequence:CCGGCCTGTGTCATTCCTTAATTTACTCGAGTAAATTAAGGAATGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-125s21c1
Sequence:CCGGATTCCCATCAAGAGCACAATGCTCGAGCATTGTGCTCTTGATGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025947.3-140s21c1
Sequence:CCGGATCATCGTGGTGAACACAGAACTCGAGTTCTGTGTTCACCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025947.3-243s21c1
Sequence:CCGGGGAGCACTGTGCGTGAGATTGCTCGAGCAATCTCACGCACAGTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025947.1-149s1c1
Sequence:CCGGCAATCCCACCACTACACAGTACTCGAGTACTGTGTAGTGGTGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025947.1-176s1c1
Sequence:CCGGCCTCATGCACAACTTCATCTTCTCGAGAAGATGAAGTTGTGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025947.1-379s1c1
Sequence:CCGGCCCAAGAATAATAGTGCTAATCTCGAGATTAGCACTATTATTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025947
VALIDATED
DYNLRB1 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, roadblock-type 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025947.3-421s21c1
Sequence:CCGGAGAATAATAGTGCTAATCATGCTCGAGCATGATTAGCACTATTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025947.2-311s1c1
Sequence:CCGGGTGATCCAGAATCCAACTGAACTCGAGTTCAGTTGGATTCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-314s21c1
Sequence:CCGGATCCAGAATCCAACTGAATAACTCGAGTTATTCAGTTGGATTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-170s21c1
Sequence:CCGGGCCAACCTCATGCACAACTTCCTCGAGGAAGTTGTGCATGAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-275s21c1
Sequence:CCGGATTATGGTGGCACCAGATAAACTCGAGTTTATCTGGTGCCACCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-351s21c1
Sequence:CCGGCCTGTGTCATTCCTTAATTTACTCGAGTAAATTAAGGAATGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-125s21c1
Sequence:CCGGATTCCCATCAAGAGCACAATGCTCGAGCATTGTGCTCTTGATGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025947.3-140s21c1
Sequence:CCGGATCATCGTGGTGAACACAGAACTCGAGTTCTGTGTTCACCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025947.3-243s21c1
Sequence:CCGGGGAGCACTGTGCGTGAGATTGCTCGAGCAATCTCACGCACAGTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025947.1-149s1c1
Sequence:CCGGCAATCCCACCACTACACAGTACTCGAGTACTGTGTAGTGGTGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025947.1-176s1c1
Sequence:CCGGCCTCATGCACAACTTCATCTTCTCGAGAAGATGAAGTTGTGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025947.1-379s1c1
Sequence:CCGGCCCAAGAATAATAGTGCTAATCTCGAGATTAGCACTATTATTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025947
VALIDATED
DYNLRB1 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, roadblock-type 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025947.3-421s21c1
Sequence:CCGGAGAATAATAGTGCTAATCATGCTCGAGCATGATTAGCACTATTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025947.2-311s1c1
Sequence:CCGGGTGATCCAGAATCCAACTGAACTCGAGTTCAGTTGGATTCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-314s21c1
Sequence:CCGGATCCAGAATCCAACTGAATAACTCGAGTTATTCAGTTGGATTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-170s21c1
Sequence:CCGGGCCAACCTCATGCACAACTTCCTCGAGGAAGTTGTGCATGAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-275s21c1
Sequence:CCGGATTATGGTGGCACCAGATAAACTCGAGTTTATCTGGTGCCACCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-351s21c1
Sequence:CCGGCCTGTGTCATTCCTTAATTTACTCGAGTAAATTAAGGAATGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025947.2-125s21c1
Sequence:CCGGATTCCCATCAAGAGCACAATGCTCGAGCATTGTGCTCTTGATGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025947.3-140s21c1
Sequence:CCGGATCATCGTGGTGAACACAGAACTCGAGTTCTGTGTTCACCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025947.3-243s21c1
Sequence:CCGGGGAGCACTGTGCGTGAGATTGCTCGAGCAATCTCACGCACAGTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025947.1-149s1c1
Sequence:CCGGCAATCCCACCACTACACAGTACTCGAGTACTGTGTAGTGGTGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025947.1-176s1c1
Sequence:CCGGCCTCATGCACAACTTCATCTTCTCGAGAAGATGAAGTTGTGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025947.1-379s1c1
Sequence:CCGGCCCAAGAATAATAGTGCTAATCTCGAGATTAGCACTATTATTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014183
VALIDATED
DYNLRB1 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, roadblock-type 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-330s21c1
Sequence:CCGGGATTCAGAATCCAACCGAATACTCGAGTATTCGGTTGGATTCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-102s21c1
Sequence:CCGGGAAGGGAGTGCAGGGAATCATCTCGAGATGATTCCCTGCACTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-190s21c1
Sequence:CCGGAGCCTCATGCACAGCTTCATCCTCGAGGATGAAGCTGTGCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-293s21c1
Sequence:CCGGTTATGGTTGCACCAGATAAAGCTCGAGCTTTATCTGGTGCAACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-368s21c1
Sequence:CCGGCCTGTGTCATTCCTTAATTTACTCGAGTAAATTAAGGAATGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014183.2-129s1c1
Sequence:CCGGGAACACAGAAGGCATTCCCATCTCGAGATGGGAATGCCTTCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014183.2-247s1c1
Sequence:CCGGCAGAACGATCTCACCTTCCTTCTCGAGAAGGAAGGTGAGATCGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014183.2-330s1c1
Sequence:CCGGGATTCAGAATCCAACCGAATACTCGAGTATTCGGTTGGATTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014183.2-321s1c1
Sequence:CCGGCCTGATTGTGATTCAGAATCCCTCGAGGGATTCTGAATCACAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014183.2-147s1c1
Sequence:CCGGCATCAAGAGCACCATGGACAACTCGAGTTGTCCATGGTGCTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014183.2-195s1c1
Sequence:CCGGCATGCACAGCTTCATCCTGAACTCGAGTTCAGGATGAAGCTGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014183.2-134s1c1
Sequence:CCGGCAGAAGGCATTCCCATCAAGACTCGAGTCTTGATGGGAATGCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014183
VALIDATED
DYNLRB1 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, roadblock-type 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-330s21c1
Sequence:CCGGGATTCAGAATCCAACCGAATACTCGAGTATTCGGTTGGATTCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-102s21c1
Sequence:CCGGGAAGGGAGTGCAGGGAATCATCTCGAGATGATTCCCTGCACTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-190s21c1
Sequence:CCGGAGCCTCATGCACAGCTTCATCCTCGAGGATGAAGCTGTGCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-293s21c1
Sequence:CCGGTTATGGTTGCACCAGATAAAGCTCGAGCTTTATCTGGTGCAACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-368s21c1
Sequence:CCGGCCTGTGTCATTCCTTAATTTACTCGAGTAAATTAAGGAATGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014183.2-129s1c1
Sequence:CCGGGAACACAGAAGGCATTCCCATCTCGAGATGGGAATGCCTTCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014183.2-247s1c1
Sequence:CCGGCAGAACGATCTCACCTTCCTTCTCGAGAAGGAAGGTGAGATCGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014183.2-330s1c1
Sequence:CCGGGATTCAGAATCCAACCGAATACTCGAGTATTCGGTTGGATTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014183.2-321s1c1
Sequence:CCGGCCTGATTGTGATTCAGAATCCCTCGAGGGATTCTGAATCACAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014183.2-147s1c1
Sequence:CCGGCATCAAGAGCACCATGGACAACTCGAGTTGTCCATGGTGCTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014183.2-195s1c1
Sequence:CCGGCATGCACAGCTTCATCCTGAACTCGAGTTCAGGATGAAGCTGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014183.2-134s1c1
Sequence:CCGGCAGAAGGCATTCCCATCAAGACTCGAGTCTTGATGGGAATGCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014183
VALIDATED
DYNLRB1 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, roadblock-type 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-330s21c1
Sequence:CCGGGATTCAGAATCCAACCGAATACTCGAGTATTCGGTTGGATTCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-102s21c1
Sequence:CCGGGAAGGGAGTGCAGGGAATCATCTCGAGATGATTCCCTGCACTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-190s21c1
Sequence:CCGGAGCCTCATGCACAGCTTCATCCTCGAGGATGAAGCTGTGCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-293s21c1
Sequence:CCGGTTATGGTTGCACCAGATAAAGCTCGAGCTTTATCTGGTGCAACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014183.2-368s21c1
Sequence:CCGGCCTGTGTCATTCCTTAATTTACTCGAGTAAATTAAGGAATGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014183.2-129s1c1
Sequence:CCGGGAACACAGAAGGCATTCCCATCTCGAGATGGGAATGCCTTCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014183.2-247s1c1
Sequence:CCGGCAGAACGATCTCACCTTCCTTCTCGAGAAGGAAGGTGAGATCGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014183.2-330s1c1
Sequence:CCGGGATTCAGAATCCAACCGAATACTCGAGTATTCGGTTGGATTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014183.2-321s1c1
Sequence:CCGGCCTGATTGTGATTCAGAATCCCTCGAGGGATTCTGAATCACAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014183.2-147s1c1
Sequence:CCGGCATCAAGAGCACCATGGACAACTCGAGTTGTCCATGGTGCTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014183.2-195s1c1
Sequence:CCGGCATGCACAGCTTCATCCTGAACTCGAGTTCAGGATGAAGCTGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014183.2-134s1c1
Sequence:CCGGCAGAAGGCATTCCCATCAAGACTCGAGTCTTGATGGGAATGCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks