EMAIL THIS PAGE TO A FRIEND

DYNLRB2

dynein, light chain, roadblock-type 2

53 Gene Product Result for
Synonyms: DNCL2B DNLC2B ROBLD2
UniProtKB ID: Q8TF09
Gene ID:
Mouse(75465) dynein light chain roadblock-type 2
Rat(361415) dynein light chain roadblock-type 2
sheep(101120685) dynein, light chain, roadblock-type 2
domestic guinea pig(100725262) dynein, light chain, roadblock-type 2
naked mole-rat(101697213) dynein, light chain, roadblock-type 2
chicken(415802) dynein, light chain, roadblock-type 2
dog(479636) dynein, light chain, roadblock-type 2
domestic cat(101083561) dynein, light chain, roadblock-type 2
cow(768062) dynein, light chain, roadblock-type 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_130897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130897 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130897 Rosetta Predictions human pricing
NM_001108451 Rosetta Predictions rat pricing
NM_029297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088414 predicted 252
2 SASI_Hs01_00088416 predicted 215
3 SASI_Hs01_00088417 predicted 218
4 SASI_Hs01_00088418 predicted 248
5 SASI_Hs01_00088419 predicted 224
6 SASI_Hs01_00088420 predicted 208
7 SASI_Hs01_00088421 predicted 224
8 SASI_Hs01_00088422 predicted 213
9 SASI_Hs01_00088423 predicted 251
10 SASI_Hs02_00362908 predicted 206
11 SASI_Hs01_00088415 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238769 predicted 294
2 SASI_Rn02_00238770 predicted 297
3 SASI_Rn02_00238771 predicted 252
4 SASI_Rn02_00238772 predicted 299
5 SASI_Rn02_00238773 predicted 310
6 SASI_Rn02_00238774 predicted 297
7 SASI_Rn02_00238775 predicted 296
8 SASI_Rn02_00238776 predicted 265
9 SASI_Rn02_00238777 predicted 209
10 SASI_Rn02_00238778 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143267 predicted 275
2 SASI_Mm01_00143268 predicted 276
3 SASI_Mm01_00143269 predicted 282
4 SASI_Mm01_00143270 predicted 235
5 SASI_Mm01_00143271 predicted 247
6 SASI_Mm02_00335113 predicted 280
7 SASI_Mm01_00143272 predicted 267
8 SASI_Mm01_00143273 predicted 239
9 SASI_Mm01_00143274 predicted 235
10 SASI_Mm01_00143275 predicted 243
11 SASI_Mm01_00143276 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029297
DYNLRB2 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, roadblock-type 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-113s1c1
Sequence:CCGGCATTCCAATCCGAACAACCCTCTCGAGAGGGTTGTTCGGATTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-191s1c1
Sequence:CCGGCAAGAGCACAGTCAGGGATATCTCGAGATATCCCTGACTGTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-302s1c1
Sequence:CCGGCATTCAGAACCCATGTGAGTACTCGAGTACTCACATGGGTTCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-85s21c1
Sequence:CCGGTCGGAACGATGGTGGTCAATGCTCGAGCATTGACCACCATCGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-238s21c1
Sequence:CCGGTTAGGATCAGATCGAAGAAACCTCGAGGTTTCTTCGATCTGATCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029297.1-338s21c1
Sequence:CCGGACCCTGTCCTCCTGACGATACCTCGAGGTATCGTCAGGAGGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-193s21c1
Sequence:CCGGAGAGCACAGTCAGGGATATTGCTCGAGCAATATCCCTGACTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-245s1c1
Sequence:CCGGCAGATCGAAGAAACATGAAATCTCGAGATTTCATGTTTCTTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-139s21c1
Sequence:CCGGACTCCACAACGGTTCAGTATGCTCGAGCATACTGAACCGTTGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029297
DYNLRB2 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, roadblock-type 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-113s1c1
Sequence:CCGGCATTCCAATCCGAACAACCCTCTCGAGAGGGTTGTTCGGATTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-191s1c1
Sequence:CCGGCAAGAGCACAGTCAGGGATATCTCGAGATATCCCTGACTGTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-302s1c1
Sequence:CCGGCATTCAGAACCCATGTGAGTACTCGAGTACTCACATGGGTTCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-85s21c1
Sequence:CCGGTCGGAACGATGGTGGTCAATGCTCGAGCATTGACCACCATCGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-238s21c1
Sequence:CCGGTTAGGATCAGATCGAAGAAACCTCGAGGTTTCTTCGATCTGATCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029297.1-338s21c1
Sequence:CCGGACCCTGTCCTCCTGACGATACCTCGAGGTATCGTCAGGAGGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-193s21c1
Sequence:CCGGAGAGCACAGTCAGGGATATTGCTCGAGCAATATCCCTGACTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-245s1c1
Sequence:CCGGCAGATCGAAGAAACATGAAATCTCGAGATTTCATGTTTCTTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-139s21c1
Sequence:CCGGACTCCACAACGGTTCAGTATGCTCGAGCATACTGAACCGTTGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029297
DYNLRB2 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, roadblock-type 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-113s1c1
Sequence:CCGGCATTCCAATCCGAACAACCCTCTCGAGAGGGTTGTTCGGATTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-191s1c1
Sequence:CCGGCAAGAGCACAGTCAGGGATATCTCGAGATATCCCTGACTGTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-302s1c1
Sequence:CCGGCATTCAGAACCCATGTGAGTACTCGAGTACTCACATGGGTTCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-85s21c1
Sequence:CCGGTCGGAACGATGGTGGTCAATGCTCGAGCATTGACCACCATCGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-238s21c1
Sequence:CCGGTTAGGATCAGATCGAAGAAACCTCGAGGTTTCTTCGATCTGATCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029297.1-338s21c1
Sequence:CCGGACCCTGTCCTCCTGACGATACCTCGAGGTATCGTCAGGAGGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-193s21c1
Sequence:CCGGAGAGCACAGTCAGGGATATTGCTCGAGCAATATCCCTGACTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029297.1-245s1c1
Sequence:CCGGCAGATCGAAGAAACATGAAATCTCGAGATTTCATGTTTCTTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029297.1-139s21c1
Sequence:CCGGACTCCACAACGGTTCAGTATGCTCGAGCATACTGAACCGTTGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130897
DYNLRB2 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, roadblock-type 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-194s1c1
Sequence:CCGGCAGAAGGTATTCCCATCCGAACTCGAGTTCGGATGGGAATACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-212s1c1
Sequence:CCGGGAACAACCTTGGACAACTCAACTCGAGTTGAGTTGTCCAAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-219s1c1
Sequence:CCGGCTTGGACAACTCAACAACTGTCTCGAGACAGTTGTTGAGTTGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-346s1c1
Sequence:CCGGCATGAAATCATGGTAGCTCCACTCGAGTGGAGCTACCATGATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-256s1c1
Sequence:CCGGCTTCATCACCTGACAATGAAACTCGAGTTTCATTGTCAGGTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-284s1c1
Sequence:CCGGGCACAGTTCGTGATATTGATCCTCGAGGATCAATATCACGAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-349s1c1
Sequence:CCGGGAAATCATGGTAGCTCCAGATCTCGAGATCTGGAGCTACCATGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-207s1c1
Sequence:CCGGCATCCGAACAACCTTGGACAACTCGAGTTGTCCAAGGTTGTTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-200s1c1
Sequence:CCGGGTATTCCCATCCGAACAACCTCTCGAGAGGTTGTTCGGATGGGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-354s1c1
Sequence:CCGGCATGGTAGCTCCAGATAAGGACTCGAGTCCTTATCTGGAGCTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-211s1c1
Sequence:CCGGCGAACAACCTTGGACAACTCACTCGAGTGAGTTGTCCAAGGTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130897
DYNLRB2 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, roadblock-type 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-194s1c1
Sequence:CCGGCAGAAGGTATTCCCATCCGAACTCGAGTTCGGATGGGAATACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-212s1c1
Sequence:CCGGGAACAACCTTGGACAACTCAACTCGAGTTGAGTTGTCCAAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-219s1c1
Sequence:CCGGCTTGGACAACTCAACAACTGTCTCGAGACAGTTGTTGAGTTGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-346s1c1
Sequence:CCGGCATGAAATCATGGTAGCTCCACTCGAGTGGAGCTACCATGATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-256s1c1
Sequence:CCGGCTTCATCACCTGACAATGAAACTCGAGTTTCATTGTCAGGTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-284s1c1
Sequence:CCGGGCACAGTTCGTGATATTGATCCTCGAGGATCAATATCACGAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-349s1c1
Sequence:CCGGGAAATCATGGTAGCTCCAGATCTCGAGATCTGGAGCTACCATGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-207s1c1
Sequence:CCGGCATCCGAACAACCTTGGACAACTCGAGTTGTCCAAGGTTGTTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-200s1c1
Sequence:CCGGGTATTCCCATCCGAACAACCTCTCGAGAGGTTGTTCGGATGGGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-354s1c1
Sequence:CCGGCATGGTAGCTCCAGATAAGGACTCGAGTCCTTATCTGGAGCTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-211s1c1
Sequence:CCGGCGAACAACCTTGGACAACTCACTCGAGTGAGTTGTCCAAGGTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130897
DYNLRB2 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, roadblock-type 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-194s1c1
Sequence:CCGGCAGAAGGTATTCCCATCCGAACTCGAGTTCGGATGGGAATACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-212s1c1
Sequence:CCGGGAACAACCTTGGACAACTCAACTCGAGTTGAGTTGTCCAAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-219s1c1
Sequence:CCGGCTTGGACAACTCAACAACTGTCTCGAGACAGTTGTTGAGTTGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-346s1c1
Sequence:CCGGCATGAAATCATGGTAGCTCCACTCGAGTGGAGCTACCATGATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-256s1c1
Sequence:CCGGCTTCATCACCTGACAATGAAACTCGAGTTTCATTGTCAGGTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-284s1c1
Sequence:CCGGGCACAGTTCGTGATATTGATCCTCGAGGATCAATATCACGAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-349s1c1
Sequence:CCGGGAAATCATGGTAGCTCCAGATCTCGAGATCTGGAGCTACCATGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-207s1c1
Sequence:CCGGCATCCGAACAACCTTGGACAACTCGAGTTGTCCAAGGTTGTTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-200s1c1
Sequence:CCGGGTATTCCCATCCGAACAACCTCTCGAGAGGTTGTTCGGATGGGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130897.1-354s1c1
Sequence:CCGGCATGGTAGCTCCAGATAAGGACTCGAGTCCTTATCTGGAGCTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130897.1-211s1c1
Sequence:CCGGCGAACAACCTTGGACAACTCACTCGAGTGAGTTGTCCAAGGTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks