EMAIL THIS PAGE TO A FRIEND

DYNLT1

dynein, light chain, Tctex-type 1

52 Gene Product Result for
Synonyms: CW-1 TCTEL1 tctex-1
UniProtKB ID: P63172, Q15763, Q5VTU4
Gene ID:
Human(6993) Summary: Cytoplasmic dynein is the major motor protein complex responsible for minus-end, microtubule-based motile processes. Each dynein complex consists of 2 heavy chains that have ATPase and motor activities, plus a group of accessory polypeptides. TCTEX1 is a dynein light chain involved in cargo binding (Chuang et al., 2005 [PubMed 15992542]
Rat(83462) dynein light chain Tctex-type 1
Zebrafish(565740) dynein, light chain, Tctex-type 1
chicken(421660) dynein, light chain, Tctex-type 1
dog(612201) dynein, light chain, Tctex-type 1
cow(282380) dynein, light chain, Tctex-type 1
domestic cat(101088753) dynein, light chain, Tctex-type 1
naked mole-rat(101721979) dynein, light chain, Tctex-type 1
domestic guinea pig(100718019) dynein, light chain, Tctex-type 1
sheep(101110149) dynein, light chain, Tctex-type 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA046559 Anti-DYNLT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
D9944 Monoclonal Anti-DYNLT1 antibody produced in mouse ~1.0 mg/mL, clone T1, purified immunoglobulin, buffered aqueous solution mouse, monkey, human, bovine, rat
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006519 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006761 MISSION® esiRNA esiRNA targeting human DYNLT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006519 Rosetta Predictions human pricing
NM_031318 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096434 predicted 399
2 SASI_Hs01_00096435 predicted 220
3 SASI_Hs01_00096436 predicted 348
4 SASI_Hs01_00096439 predicted 440
5 SASI_Hs02_00341755 predicted 441
6 SASI_Hs02_00341756 predicted 271
7 SASI_Hs01_00096440 predicted 398
8 SASI_Hs01_00096441 predicted 388
9 SASI_Hs01_00096442 predicted 398
10 SASI_Hs02_00341757 predicted 316
11 SASI_Hs01_00096437 predicted 320
12 SASI_Hs01_00096438 predicted 236
13 SASI_Hs01_00096443 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031386 predicted 403
2 SASI_Rn01_00031387 predicted 298
3 SASI_Rn01_00031388 predicted 225
4 SASI_Rn01_00031389 predicted 380
5 SASI_Rn01_00031390 predicted 251
6 SASI_Rn01_00031391 predicted 418
7 SASI_Rn01_00031392 predicted 325
8 SASI_Rn02_00264537 predicted 416
9 SASI_Rn02_00264538 predicted 384
10 SASI_Rn02_00264539 predicted 381
11 SASI_Rn01_00031393 predicted 321
12 SASI_Rn01_00031394 predicted 427
13 SASI_Rn01_00031395 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006519
VALIDATED
DYNLT1 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, Tctex-type 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006519.1-198s21c1
Sequence:CCGGCTGTGTAATTATGCAGAAGAACTCGAGTTCTTCTGCATAATTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-221s21c1
Sequence:CCGGGAGCTGGATTACACACAGCAACTCGAGTTGCTGTGTGTAATCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-40s21c1
Sequence:CCGGGTTGATGAAGTGAGCAACATTCTCGAGAATGTTGCTCACTTCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-128s21c1
Sequence:CCGGCCACAAATGTAGTAGAACAAACTCGAGTTTGTTCTACTACATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-67s21c1
Sequence:CCGGGAGGCTATAGAAAGCGCAATTCTCGAGAATTGCGCTTTCTATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-128s1c1
Sequence:CCGGCCACAAATGTAGTAGAACAAACTCGAGTTTGTTCTACTACATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-221s1c1
Sequence:CCGGGAGCTGGATTACACACAGCAACTCGAGTTGCTGTGTGTAATCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-67s1c1
Sequence:CCGGGAGGCTATAGAAAGCGCAATTCTCGAGAATTGCGCTTTCTATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-40s1c1
Sequence:CCGGGTTGATGAAGTGAGCAACATTCTCGAGAATGTTGCTCACTTCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-198s1c1
Sequence:CCGGCTGTGTAATTATGCAGAAGAACTCGAGTTCTTCTGCATAATTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006519
VALIDATED
DYNLT1 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, Tctex-type 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006519.1-198s21c1
Sequence:CCGGCTGTGTAATTATGCAGAAGAACTCGAGTTCTTCTGCATAATTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-221s21c1
Sequence:CCGGGAGCTGGATTACACACAGCAACTCGAGTTGCTGTGTGTAATCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-40s21c1
Sequence:CCGGGTTGATGAAGTGAGCAACATTCTCGAGAATGTTGCTCACTTCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-128s21c1
Sequence:CCGGCCACAAATGTAGTAGAACAAACTCGAGTTTGTTCTACTACATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-67s21c1
Sequence:CCGGGAGGCTATAGAAAGCGCAATTCTCGAGAATTGCGCTTTCTATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-128s1c1
Sequence:CCGGCCACAAATGTAGTAGAACAAACTCGAGTTTGTTCTACTACATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-221s1c1
Sequence:CCGGGAGCTGGATTACACACAGCAACTCGAGTTGCTGTGTGTAATCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-67s1c1
Sequence:CCGGGAGGCTATAGAAAGCGCAATTCTCGAGAATTGCGCTTTCTATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-40s1c1
Sequence:CCGGGTTGATGAAGTGAGCAACATTCTCGAGAATGTTGCTCACTTCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-198s1c1
Sequence:CCGGCTGTGTAATTATGCAGAAGAACTCGAGTTCTTCTGCATAATTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006519
VALIDATED
DYNLT1 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, Tctex-type 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006519.1-198s21c1
Sequence:CCGGCTGTGTAATTATGCAGAAGAACTCGAGTTCTTCTGCATAATTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-221s21c1
Sequence:CCGGGAGCTGGATTACACACAGCAACTCGAGTTGCTGTGTGTAATCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-40s21c1
Sequence:CCGGGTTGATGAAGTGAGCAACATTCTCGAGAATGTTGCTCACTTCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-128s21c1
Sequence:CCGGCCACAAATGTAGTAGAACAAACTCGAGTTTGTTCTACTACATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006519.1-67s21c1
Sequence:CCGGGAGGCTATAGAAAGCGCAATTCTCGAGAATTGCGCTTTCTATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-128s1c1
Sequence:CCGGCCACAAATGTAGTAGAACAAACTCGAGTTTGTTCTACTACATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-221s1c1
Sequence:CCGGGAGCTGGATTACACACAGCAACTCGAGTTGCTGTGTGTAATCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-67s1c1
Sequence:CCGGGAGGCTATAGAAAGCGCAATTCTCGAGAATTGCGCTTTCTATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-40s1c1
Sequence:CCGGGTTGATGAAGTGAGCAACATTCTCGAGAATGTTGCTCACTTCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006519.1-198s1c1
Sequence:CCGGCTGTGTAATTATGCAGAAGAACTCGAGTTCTTCTGCATAATTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks