EMAIL THIS PAGE TO A FRIEND

DYNLT3

dynein, light chain, Tctex-type 3

152 Gene Product Result for
Synonyms: RP3 TCTE1L TCTEX1L
UniProtKB ID: P51808
Gene ID:
Human(6990) Summary: This gene encodes a member of a subclass of dynein light chains. The encoded protein homodimerizes and forms the light chain component of the cytoplasmic dynein motor protein complex. This protein may be important for binding dynein to specific cargos including the spindle checkpoint protein BUB3. This protein may also function independently of dynein as a transcriptional modulator. Pseudogenes of this gene are found on chromosomes 2 and 20.[provided by RefSeq, Mar 2010]
Mouse(67117) dynein light chain Tctex-type 3
Rat(363448) dynein light chain Tctex-type 3
sheep(443256) dynein, light chain, Tctex-type 3
domestic guinea pig(100735278) dynein, light chain, Tctex-type 3
naked mole-rat(101709155) dynein, light chain, Tctex-type 3
Zebrafish(402901) dynein, light chain, Tctex-type 3
cow(613349) dynein, light chain, Tctex-type 3
domestic cat(101086627) dynein, light chain, Tctex-type 3
dog(403505) dynein, light chain, Tctex-type 3
chicken(418580) dynein, light chain, Tctex-type 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006520 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006520 Rosetta Predictions human pricing
NM_001013228 Rosetta Predictions rat pricing
NM_025975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147343 predicted 567
2 SASI_Hs02_00341758 predicted 353
3 SASI_Hs01_00147344 predicted 288
4 SASI_Hs02_00341759 predicted 485
5 SASI_Hs01_00147346 predicted 213
6 SASI_Hs01_00147347 predicted 338
7 SASI_Hs02_00341760 predicted 590
8 SASI_Hs01_00147348 predicted 299
9 SASI_Hs01_00147349 predicted 327
10 SASI_Hs01_00147350 predicted 248
11 SASI_Hs01_00147342 predicted 378
12 SASI_Hs01_00147345 predicted 396
13 SASI_Hs01_00147351 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201040 predicted 427
2 SASI_Rn01_00036843 predicted 402
3 SASI_Rn01_00036844 predicted 446
4 SASI_Rn01_00036845 predicted 317
5 SASI_Rn01_00036846 predicted 334
6 SASI_Rn02_00201041 predicted 512
7 SASI_Rn01_00036847 predicted 393
8 SASI_Rn01_00036848 predicted 504
9 SASI_Rn01_00036850 predicted 541
10 SASI_Rn01_00036851 predicted 662
11 SASI_Rn01_00036849 predicted 577
12 SASI_Rn01_00036852 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146624 predicted 501
2 SASI_Mm01_00146625 predicted 675
3 SASI_Mm01_00146626 predicted 221
4 SASI_Mm01_00146627 predicted 589
5 SASI_Mm01_00146628 predicted 621
6 SASI_Mm01_00146629 predicted 454
7 SASI_Mm01_00146630 predicted 545
8 SASI_Mm01_00146631 predicted 335
9 SASI_Mm01_00146632 predicted 384
10 SASI_Mm01_00146633 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025975
DYNLT3 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, Tctex-type 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025975.3-1416s1c1
Sequence:CCGGCCCAGAAAGTAATACATCAAACTCGAGTTTGATGTATTACTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-223s1c1
Sequence:CCGGGCATAGTGGAACAGTCTATAACTCGAGTTATAGACTGTTCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-135s1c1
Sequence:CCGGGAAGCCCATAATATAGTCAAACTCGAGTTTGACTATATTATGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-365s1c1
Sequence:CCGGCTGTACCATCAGATGGGAGAACTCGAGTTCTCCCATCTGATGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-220s1c1
Sequence:CCGGCAAGCATAGTGGAACAGTCTACTCGAGTAGACTGTTCCACTATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025975
DYNLT3 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, Tctex-type 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025975.3-1416s1c1
Sequence:CCGGCCCAGAAAGTAATACATCAAACTCGAGTTTGATGTATTACTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-223s1c1
Sequence:CCGGGCATAGTGGAACAGTCTATAACTCGAGTTATAGACTGTTCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-135s1c1
Sequence:CCGGGAAGCCCATAATATAGTCAAACTCGAGTTTGACTATATTATGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-365s1c1
Sequence:CCGGCTGTACCATCAGATGGGAGAACTCGAGTTCTCCCATCTGATGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-220s1c1
Sequence:CCGGCAAGCATAGTGGAACAGTCTACTCGAGTAGACTGTTCCACTATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025975
DYNLT3 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, Tctex-type 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025975.3-1416s1c1
Sequence:CCGGCCCAGAAAGTAATACATCAAACTCGAGTTTGATGTATTACTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-223s1c1
Sequence:CCGGGCATAGTGGAACAGTCTATAACTCGAGTTATAGACTGTTCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-135s1c1
Sequence:CCGGGAAGCCCATAATATAGTCAAACTCGAGTTTGACTATATTATGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-365s1c1
Sequence:CCGGCTGTACCATCAGATGGGAGAACTCGAGTTCTCCCATCTGATGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025975.3-220s1c1
Sequence:CCGGCAAGCATAGTGGAACAGTCTACTCGAGTAGACTGTTCCACTATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006520
VALIDATED
DYNLT3 MISSION shRNA Bacterial Glycerol Stock
dynein, light chain, Tctex-type 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006520.1-1671s1c1
Sequence:CCGGGCGAAGTCAATCTGCTACTTACTCGAGTAAGTAGCAGATTGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006520.1-365s1c1
Sequence:CCGGGAACCGGACCATGAACTGTATCTCGAGATACAGTTCATGGTCCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006520.1-111s1c1
Sequence:CCGGGCTGAGGAAGCCCACAATATTCTCGAGAATATTGTGGGCTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006520.1-205s1c1
Sequence:CCGGGCATAGTGGAACAATCCTTAACTCGAGTTAAGGATTGTTCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006520.1-347s1c1
Sequence:CCGGCTGTACCGTAAGATGGGAGAACTCGAGTTCTCCCATCTTACGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-263s21c1
Sequence:CCGGGCATAGTGGAACAATCCTTAACTCGAGTTAAGGATTGTTCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-334s21c1
Sequence:CCGGGTGGTCCAGAAGAGCGCATATCTCGAGATATGCGCTCTTCTGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-215s21c1
Sequence:CCGGTAGGTGGTGAAGATTATAATCCTCGAGGATTATAATCTTCACCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-661s21c1
Sequence:CCGGTCTATACAGCATCGTTTAAATCTCGAGATTTAAACGATGCTGTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006520.2-405s21c1
Sequence:CCGGCTGTACCGTAAGATGGGAGAACTCGAGTTCTCCCATCTTACGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006520
VALIDATED
DYNLT3 MISSION shRNA shRNA Plasmid DNA
dynein, light chain, Tctex-type 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006520.1-1671s1c1
Sequence:CCGGGCGAAGTCAATCTGCTACTTACTCGAGTAAGTAGCAGATTGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006520.1-365s1c1
Sequence:CCGGGAACCGGACCATGAACTGTATCTCGAGATACAGTTCATGGTCCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006520.1-111s1c1
Sequence:CCGGGCTGAGGAAGCCCACAATATTCTCGAGAATATTGTGGGCTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006520.1-205s1c1
Sequence:CCGGGCATAGTGGAACAATCCTTAACTCGAGTTAAGGATTGTTCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006520.1-347s1c1
Sequence:CCGGCTGTACCGTAAGATGGGAGAACTCGAGTTCTCCCATCTTACGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-263s21c1
Sequence:CCGGGCATAGTGGAACAATCCTTAACTCGAGTTAAGGATTGTTCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-334s21c1
Sequence:CCGGGTGGTCCAGAAGAGCGCATATCTCGAGATATGCGCTCTTCTGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-215s21c1
Sequence:CCGGTAGGTGGTGAAGATTATAATCCTCGAGGATTATAATCTTCACCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-661s21c1
Sequence:CCGGTCTATACAGCATCGTTTAAATCTCGAGATTTAAACGATGCTGTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006520.2-405s21c1
Sequence:CCGGCTGTACCGTAAGATGGGAGAACTCGAGTTCTCCCATCTTACGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006520
VALIDATED
DYNLT3 MISSION shRNA Lentiviral Transduction Particles
dynein, light chain, Tctex-type 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006520.1-1671s1c1
Sequence:CCGGGCGAAGTCAATCTGCTACTTACTCGAGTAAGTAGCAGATTGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006520.1-365s1c1
Sequence:CCGGGAACCGGACCATGAACTGTATCTCGAGATACAGTTCATGGTCCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006520.1-111s1c1
Sequence:CCGGGCTGAGGAAGCCCACAATATTCTCGAGAATATTGTGGGCTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006520.1-205s1c1
Sequence:CCGGGCATAGTGGAACAATCCTTAACTCGAGTTAAGGATTGTTCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006520.1-347s1c1
Sequence:CCGGCTGTACCGTAAGATGGGAGAACTCGAGTTCTCCCATCTTACGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-263s21c1
Sequence:CCGGGCATAGTGGAACAATCCTTAACTCGAGTTAAGGATTGTTCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-334s21c1
Sequence:CCGGGTGGTCCAGAAGAGCGCATATCTCGAGATATGCGCTCTTCTGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-215s21c1
Sequence:CCGGTAGGTGGTGAAGATTATAATCCTCGAGGATTATAATCTTCACCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006520.2-661s21c1
Sequence:CCGGTCTATACAGCATCGTTTAAATCTCGAGATTTAAACGATGCTGTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006520.2-405s21c1
Sequence:CCGGCTGTACCGTAAGATGGGAGAACTCGAGTTCTCCCATCTTACGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks