EMAIL THIS PAGE TO A FRIEND

DYRK1A

dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A

360 Gene Product Result for
Synonyms: DYRK DYRK1 HP86 MNB MNBH MRD7
UniProtKB ID: Q13627, O60769, Q92582, Q92810, Q9UNM5
Gene ID:
Human(1859) Summary: This gene encodes a member of the Dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family. This member contains a nuclear targeting signal sequence, a protein kinase domain, a leucine zipper motif, and a highly conservative 13-consecutive-histidine repeat. It catalyzes its autophosphorylation on serine/threonine and tyrosine residues. It may play a significant role in a signaling pathway regulating cell proliferation and may be involved in brain development. This gene is a homolog of Drosophila mnb (minibrain) gene and rat Dyrk gene. It is localized in the Down syndrome critical region of chromosome 21, and is considered to be a strong candidate gene for learning defects associated with Down syndrome. Alternative splicing of this gene generates several transcript variants differing from each other either in the 5' UTR or in the 3' coding region. These variants encode at least five different isoforms. [provided by RefSeq, Jul 2008]
Mouse(13548) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a
Rat(25255) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
chicken(395233) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
domestic cat(101100581) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Horse(100051707) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
cow(532989) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
dog(487755) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
naked mole-rat(101719681) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
domestic guinea pig(100714823) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
sheep(101117130) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Domestic Rabbit(100350296) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E2250 Ellagic acid ≥95% (HPLC), powder, from tree bark human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001396 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130437 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001396 siRNAs that have been validated in the lab human pricing
NM_101395 Rosetta Predictions human pricing
NM_130436 siRNAs that have been validated in the lab human pricing
NM_130437 Rosetta Predictions human pricing
NM_130438 Rosetta Predictions human pricing
NM_012791 Rosetta Predictions rat pricing
NM_001113389 Rosetta Predictions mouse pricing
NM_007890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001396 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123259 validated 2154
2 SASI_Hs01_00123260 predicted 972
3 SASI_Hs01_00123261 predicted 1200
4 SASI_Hs01_00123262 predicted 836
5 SASI_Hs02_00331761 predicted 843
6 SASI_Hs01_00123264 predicted 574
7 SASI_Hs01_00123265 predicted 854
8 SASI_Hs01_00123266 predicted 2148
9 SASI_Hs01_00123267 predicted 2169
10 SASI_Hs01_00123268 predicted 1024
11 SASI_Hs01_00123263 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_101395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157429 predicted 1141
2 SASI_Hs01_00157430 predicted 1374
3 SASI_Hs01_00157431 predicted 1014
4 SASI_Hs01_00157433 predicted 1020
5 SASI_Hs01_00157434 predicted 751
6 SASI_Hs01_00157435 predicted 1030
7 SASI_Hs01_00157436 predicted 913
8 SASI_Hs02_00362696 predicted 1419
9 SASI_Hs02_00362697 predicted 1448
10 SASI_Hs01_00157437 predicted 1190
11 SASI_Hs01_00157432 predicted 980
12 SASI_Hs01_00157438 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130436 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048110 validated 3527
2 SASI_Hs01_00048111 predicted 2335
3 SASI_Hs01_00048112 predicted 2565
4 SASI_Hs01_00048113 predicted 2206
5 SASI_Hs02_00362732 predicted 2207
6 SASI_Hs01_00048115 predicted 1936
7 SASI_Hs01_00048116 predicted 2226
8 SASI_Hs01_00048117 predicted 3522
9 SASI_Hs01_00048118 predicted 3528
10 SASI_Hs01_00048119 predicted 2386
11 SASI_Hs01_00048114 predicted 2179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168560 predicted 969
2 SASI_Hs01_00168561 predicted 1203
3 SASI_Hs01_00168562 predicted 839
4 SASI_Hs01_00168564 predicted 844
5 SASI_Hs01_00168565 predicted 572
6 SASI_Hs01_00168566 predicted 860
7 SASI_Hs01_00168567 predicted 736
8 SASI_Hs02_00362733 predicted 1245
9 SASI_Hs02_00362734 predicted 1282
10 SASI_Hs01_00168568 predicted 1022
11 SASI_Hs01_00168563 predicted 808
12 SASI_Hs01_00168569 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143350 predicted 976
2 SASI_Hs01_00143351 predicted 1203
3 SASI_Hs01_00143352 predicted 839
4 SASI_Hs01_00143354 predicted 839
5 SASI_Hs01_00143355 predicted 578
6 SASI_Hs01_00143356 predicted 859
7 SASI_Hs01_00143357 predicted 741
8 SASI_Hs02_00362735 predicted 1250
9 SASI_Hs02_00362736 predicted 1284
10 SASI_Hs01_00143358 predicted 1023
11 SASI_Hs01_00143353 predicted 810
12 SASI_Hs01_00143359 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057175 predicted 2214
2 SASI_Rn01_00057176 predicted 1152
3 SASI_Rn02_00260214 predicted 2294
4 SASI_Rn02_00260215 predicted 1299
5 SASI_Rn01_00057179 predicted 535
6 SASI_Rn01_00057180 predicted 1033
7 SASI_Rn01_00057181 predicted 2185
8 SASI_Rn01_00057182 predicted 852
9 SASI_Rn01_00057183 predicted 1130
10 SASI_Rn01_00057184 predicted 1164
11 SASI_Rn01_00057177 predicted 997
12 SASI_Rn01_00057178 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307658 predicted 2231
2 SASI_Mm02_00307659 predicted 868
3 SASI_Mm02_00307660 predicted 2308
4 SASI_Mm02_00307661 predicted 1046
5 SASI_Mm02_00307662 predicted 1350
6 SASI_Mm02_00307663 predicted 836
7 SASI_Mm02_00307664 predicted 559
8 SASI_Mm02_00307665 predicted 524
9 SASI_Mm02_00307666 predicted 1146
10 SASI_Mm02_00307667 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135130 predicted 2487
2 SASI_Mm01_00135131 predicted 1119
3 SASI_Mm01_00135132 predicted 2568
4 SASI_Mm01_00135133 predicted 1302
5 SASI_Mm02_00312678 predicted 1605
6 SASI_Mm01_00135135 predicted 1089
7 SASI_Mm01_00135137 predicted 813
8 SASI_Mm01_00135138 predicted 781
9 SASI_Mm01_00135139 predicted 1409
10 SASI_Mm02_00312679 predicted 994
11 SASI_Mm01_00135134 predicted 2095
12 SASI_Mm01_00135136 predicted 831
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007890
VALIDATED
DYRK1A MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-1602s21c1
Sequence:CCGGCGATGGCACTTGGAGCTTAAACTCGAGTTTAAGCTCCAAGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-1801s21c1
Sequence:CCGGACTCGGATTCAACCTTATTATCTCGAGATAATAAGGTTGAATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-2489s21c1
Sequence:CCGGATGGAGCTATGGACGTTAATTCTCGAGAATTAACGTCCATAGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-821s21c1
Sequence:CCGGGTTACGATGATGATAACTATGCTCGAGCATAGTTATCATCATCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007890.2-3012s21c1
Sequence:CCGGTTGGTCATTTGCCAACTAATTCTCGAGAATTAGTTGGCAAATGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007890.1-1374s1c1
Sequence:CCGGGCTGACTACTTGAAGTTCAAACTCGAGTTTGAACTTCAAGTAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007890.1-2217s1c1
Sequence:CCGGCCTGCACATTACATGACTGAACTCGAGTTCAGTCATGTAATGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007890.1-1232s1c1
Sequence:CCGGCGATGGCACTTGGAGCTTAAACTCGAGTTTAAGCTCCAAGTGCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007890.1-933s1c1
Sequence:CCGGCGGAGTGCAATCAAGATTGTTCTCGAGAACAATCTTGATTGCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007890.1-507s1c1
Sequence:CCGGCGGTATGAAATCGACTCCTTACTCGAGTAAGGAGTCGATTTCATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007890
VALIDATED
DYRK1A MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-1602s21c1
Sequence:CCGGCGATGGCACTTGGAGCTTAAACTCGAGTTTAAGCTCCAAGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-1801s21c1
Sequence:CCGGACTCGGATTCAACCTTATTATCTCGAGATAATAAGGTTGAATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-2489s21c1
Sequence:CCGGATGGAGCTATGGACGTTAATTCTCGAGAATTAACGTCCATAGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-821s21c1
Sequence:CCGGGTTACGATGATGATAACTATGCTCGAGCATAGTTATCATCATCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007890.2-3012s21c1
Sequence:CCGGTTGGTCATTTGCCAACTAATTCTCGAGAATTAGTTGGCAAATGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007890.1-1374s1c1
Sequence:CCGGGCTGACTACTTGAAGTTCAAACTCGAGTTTGAACTTCAAGTAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007890.1-2217s1c1
Sequence:CCGGCCTGCACATTACATGACTGAACTCGAGTTCAGTCATGTAATGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007890.1-1232s1c1
Sequence:CCGGCGATGGCACTTGGAGCTTAAACTCGAGTTTAAGCTCCAAGTGCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007890.1-933s1c1
Sequence:CCGGCGGAGTGCAATCAAGATTGTTCTCGAGAACAATCTTGATTGCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007890.1-507s1c1
Sequence:CCGGCGGTATGAAATCGACTCCTTACTCGAGTAAGGAGTCGATTTCATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007890
VALIDATED
DYRK1A MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-1602s21c1
Sequence:CCGGCGATGGCACTTGGAGCTTAAACTCGAGTTTAAGCTCCAAGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-1801s21c1
Sequence:CCGGACTCGGATTCAACCTTATTATCTCGAGATAATAAGGTTGAATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-2489s21c1
Sequence:CCGGATGGAGCTATGGACGTTAATTCTCGAGAATTAACGTCCATAGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007890.2-821s21c1
Sequence:CCGGGTTACGATGATGATAACTATGCTCGAGCATAGTTATCATCATCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007890.2-3012s21c1
Sequence:CCGGTTGGTCATTTGCCAACTAATTCTCGAGAATTAGTTGGCAAATGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007890.1-1374s1c1
Sequence:CCGGGCTGACTACTTGAAGTTCAAACTCGAGTTTGAACTTCAAGTAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007890.1-2217s1c1
Sequence:CCGGCCTGCACATTACATGACTGAACTCGAGTTCAGTCATGTAATGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007890.1-1232s1c1
Sequence:CCGGCGATGGCACTTGGAGCTTAAACTCGAGTTTAAGCTCCAAGTGCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007890.1-933s1c1
Sequence:CCGGCGGAGTGCAATCAAGATTGTTCTCGAGAACAATCTTGATTGCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007890.1-507s1c1
Sequence:CCGGCGGTATGAAATCGACTCCTTACTCGAGTAAGGAGTCGATTTCATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001396
VALIDATED
DYRK1A MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-4275s21c1
Sequence:CCGGCCTCTGCCGATAACCTGTTTACTCGAGTAAACAGGTTATCGGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-673s21c1
Sequence:CCGGGCACAGATAGAAGTGCGACTTCTCGAGAAGTCGCACTTCTATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-1105s21c1
Sequence:CCGGATGTGGTCCCTCGGGTGTATTCTCGAGAATACACCCGAGGGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-118s21c1
Sequence:CCGGGTTCGGCTTGCACCGTCATTTCTCGAGAAATGACGGTGCAAGCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001396.3-472s21c1
Sequence:CCGGCGGAAGGTTTACAATGATGGTCTCGAGACCATCATTGTAAACCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-2148s1c1
Sequence:CCGGCTTTGGACAGAATGGAGCTATCTCGAGATAGCTCCATTCTGTCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-472s1c1
Sequence:CCGGCGGAAGGTTTACAATGATGGTCTCGAGACCATCATTGTAAACCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-1033s1c1
Sequence:CCGGCAGTATATTCAGAGTCGCTTTCTCGAGAAAGCGACTCTGAATATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-2131s1c1
Sequence:CCGGGCTGCTAATACCTTGGACTTTCTCGAGAAAGTCCAAGGTATTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001396.x-3947s1c1
Sequence:CCGGCCAGCAGTTGATTCTTGTATTCTCGAGAATACAAGAATCAACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.2-673s1c1
Sequence:CCGGGCACAGATAGAAGTGCGACTTCTCGAGAAGTCGCACTTCTATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001396.2-179s1c1
Sequence:CCGGCCCATTCACATCAGTACAGTGCTCGAGCACTGTACTGATGTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001396.2-289s1c1
Sequence:CCGGCCTGATATTGTCATGTTACAGCTCGAGCTGTAACATGACAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001396.2-4141s1c1
Sequence:CCGGGCTAAATTTGTGTTCCCATTTCTCGAGAAATGGGAACACAAATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.2-2157s1c1
Sequence:CCGGGAATGGAGCTATGGACGTTAACTCGAGTTAACGTCCATAGCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.2-4275s1c1
Sequence:CCGGCCTCTGCCGATAACCTGTTTACTCGAGTAAACAGGTTATCGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001396
VALIDATED
DYRK1A MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-4275s21c1
Sequence:CCGGCCTCTGCCGATAACCTGTTTACTCGAGTAAACAGGTTATCGGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-673s21c1
Sequence:CCGGGCACAGATAGAAGTGCGACTTCTCGAGAAGTCGCACTTCTATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-1105s21c1
Sequence:CCGGATGTGGTCCCTCGGGTGTATTCTCGAGAATACACCCGAGGGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-118s21c1
Sequence:CCGGGTTCGGCTTGCACCGTCATTTCTCGAGAAATGACGGTGCAAGCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001396.3-472s21c1
Sequence:CCGGCGGAAGGTTTACAATGATGGTCTCGAGACCATCATTGTAAACCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-2148s1c1
Sequence:CCGGCTTTGGACAGAATGGAGCTATCTCGAGATAGCTCCATTCTGTCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-472s1c1
Sequence:CCGGCGGAAGGTTTACAATGATGGTCTCGAGACCATCATTGTAAACCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-1033s1c1
Sequence:CCGGCAGTATATTCAGAGTCGCTTTCTCGAGAAAGCGACTCTGAATATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-2131s1c1
Sequence:CCGGGCTGCTAATACCTTGGACTTTCTCGAGAAAGTCCAAGGTATTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001396.x-3947s1c1
Sequence:CCGGCCAGCAGTTGATTCTTGTATTCTCGAGAATACAAGAATCAACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.2-673s1c1
Sequence:CCGGGCACAGATAGAAGTGCGACTTCTCGAGAAGTCGCACTTCTATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001396.2-179s1c1
Sequence:CCGGCCCATTCACATCAGTACAGTGCTCGAGCACTGTACTGATGTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001396.2-289s1c1
Sequence:CCGGCCTGATATTGTCATGTTACAGCTCGAGCTGTAACATGACAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001396.2-4141s1c1
Sequence:CCGGGCTAAATTTGTGTTCCCATTTCTCGAGAAATGGGAACACAAATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.2-2157s1c1
Sequence:CCGGGAATGGAGCTATGGACGTTAACTCGAGTTAACGTCCATAGCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.2-4275s1c1
Sequence:CCGGCCTCTGCCGATAACCTGTTTACTCGAGTAAACAGGTTATCGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001396
VALIDATED
DYRK1A MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-4275s21c1
Sequence:CCGGCCTCTGCCGATAACCTGTTTACTCGAGTAAACAGGTTATCGGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-673s21c1
Sequence:CCGGGCACAGATAGAAGTGCGACTTCTCGAGAAGTCGCACTTCTATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-1105s21c1
Sequence:CCGGATGTGGTCCCTCGGGTGTATTCTCGAGAATACACCCGAGGGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001396.3-118s21c1
Sequence:CCGGGTTCGGCTTGCACCGTCATTTCTCGAGAAATGACGGTGCAAGCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001396.3-472s21c1
Sequence:CCGGCGGAAGGTTTACAATGATGGTCTCGAGACCATCATTGTAAACCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-2148s1c1
Sequence:CCGGCTTTGGACAGAATGGAGCTATCTCGAGATAGCTCCATTCTGTCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-472s1c1
Sequence:CCGGCGGAAGGTTTACAATGATGGTCTCGAGACCATCATTGTAAACCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-1033s1c1
Sequence:CCGGCAGTATATTCAGAGTCGCTTTCTCGAGAAAGCGACTCTGAATATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.x-2131s1c1
Sequence:CCGGGCTGCTAATACCTTGGACTTTCTCGAGAAAGTCCAAGGTATTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001396.x-3947s1c1
Sequence:CCGGCCAGCAGTTGATTCTTGTATTCTCGAGAATACAAGAATCAACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.2-673s1c1
Sequence:CCGGGCACAGATAGAAGTGCGACTTCTCGAGAAGTCGCACTTCTATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001396.2-179s1c1
Sequence:CCGGCCCATTCACATCAGTACAGTGCTCGAGCACTGTACTGATGTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001396.2-289s1c1
Sequence:CCGGCCTGATATTGTCATGTTACAGCTCGAGCTGTAACATGACAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001396.2-4141s1c1
Sequence:CCGGGCTAAATTTGTGTTCCCATTTCTCGAGAAATGGGAACACAAATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.2-2157s1c1
Sequence:CCGGGAATGGAGCTATGGACGTTAACTCGAGTTAACGTCCATAGCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001396.2-4275s1c1
Sequence:CCGGCCTCTGCCGATAACCTGTTTACTCGAGTAAACAGGTTATCGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130437
VALIDATED
DYRK1A MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-2090s1c1
Sequence:CCGGGCTGCTAATACCTTGGACTTTCTCGAGAAAGTCCAAGGTATTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-473s1c1
Sequence:CCGGCGGAAGGTTTACAATGATGGTCTCGAGACCATCATTGTAAACCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-1034s1c1
Sequence:CCGGCAGTATATTCAGAGTCGCTTTCTCGAGAAAGCGACTCTGAATATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-590s1c1
Sequence:CCGGCAGGTTGTAAAGGCATATGATCTCGAGATCATATGCCTTTACAACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-259s1c1
Sequence:CCGGGATTCAGCAACCTCTAACTAACTCGAGTTAGTTAGAGGTTGCTGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130437
VALIDATED
DYRK1A MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-2090s1c1
Sequence:CCGGGCTGCTAATACCTTGGACTTTCTCGAGAAAGTCCAAGGTATTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-473s1c1
Sequence:CCGGCGGAAGGTTTACAATGATGGTCTCGAGACCATCATTGTAAACCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-1034s1c1
Sequence:CCGGCAGTATATTCAGAGTCGCTTTCTCGAGAAAGCGACTCTGAATATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-590s1c1
Sequence:CCGGCAGGTTGTAAAGGCATATGATCTCGAGATCATATGCCTTTACAACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-259s1c1
Sequence:CCGGGATTCAGCAACCTCTAACTAACTCGAGTTAGTTAGAGGTTGCTGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130437
VALIDATED
DYRK1A MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-2090s1c1
Sequence:CCGGGCTGCTAATACCTTGGACTTTCTCGAGAAAGTCCAAGGTATTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-473s1c1
Sequence:CCGGCGGAAGGTTTACAATGATGGTCTCGAGACCATCATTGTAAACCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-1034s1c1
Sequence:CCGGCAGTATATTCAGAGTCGCTTTCTCGAGAAAGCGACTCTGAATATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-590s1c1
Sequence:CCGGCAGGTTGTAAAGGCATATGATCTCGAGATCATATGCCTTTACAACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_130437.x-259s1c1
Sequence:CCGGGATTCAGCAACCTCTAACTAACTCGAGTTAGTTAGAGGTTGCTGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks