EMAIL THIS PAGE TO A FRIEND

DYRK1B

dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B

139 Gene Product Result for
Synonyms: MIRK
UniProtKB ID: Q9Y463, O75258, O75788, O75789
Gene ID:
Human(9149) Summary: DYRK1B is a member of the DYRK family of protein kinases. DYRK1B contains a bipartite nuclear localization signal and is found mainly in muscle and testis. The protein is proposed to be involved in the regulation of nuclear functions. Three isoforms of DYRK1B have been identified differing in the presence of two alternatively spliced exons within the catalytic domain. [provided by RefSeq, Jul 2008]
Mouse(13549) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b
Rat(308468) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b
Zebrafish(556212) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
cow(507571) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
domestic cat(101095062) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
dog(484506) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
sheep(101117958) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
Domestic Rabbit(100344122) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
domestic guinea pig(100722034) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
naked mole-rat(101714893) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004714 siRNAs that have been validated in the lab human pricing
NM_006483 Rosetta Predictions human pricing
NM_006484 Rosetta Predictions human pricing
NM_001107496 Rosetta Predictions rat pricing
NM_001037957 Rosetta Predictions mouse pricing
NM_010092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004714 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215157 validated 808
2 SASI_Hs02_00338177 predicted 680
3 SASI_Hs01_00215159 predicted 904
4 SASI_Hs01_00215160 predicted 964
5 SASI_Hs01_00215161 predicted 459
6 SASI_Hs02_00338178 predicted 937
7 SASI_Hs01_00215162 predicted 823
8 SASI_Hs01_00215163 predicted 443
9 SASI_Hs01_00215165 predicted 1766
10 SASI_Hs01_00215166 predicted 448
11 SASI_Hs01_00215158 predicted 545
12 SASI_Hs01_00215164 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181381 predicted 804
2 SASI_Hs02_00341666 predicted 783
3 SASI_Hs02_00341667 predicted 674
4 SASI_Hs01_00181383 predicted 908
5 SASI_Hs01_00181384 predicted 967
6 SASI_Hs01_00181385 predicted 453
7 SASI_Hs01_00181386 predicted 935
8 SASI_Hs01_00181387 predicted 824
9 SASI_Hs01_00181388 predicted 440
10 SASI_Hs01_00181390 predicted 1637
11 SASI_Hs01_00181382 predicted 538
12 SASI_Hs01_00181389 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234736 predicted 804
2 SASI_Hs02_00341668 predicted 680
3 SASI_Hs01_00234738 predicted 905
4 SASI_Hs01_00234739 predicted 971
5 SASI_Hs01_00234740 predicted 459
6 SASI_Hs02_00341669 predicted 938
7 SASI_Hs01_00234741 predicted 827
8 SASI_Hs01_00234742 predicted 440
9 SASI_Hs01_00234744 predicted 1673
10 SASI_Hs01_00234745 predicted 447
11 SASI_Hs01_00234737 predicted 539
12 SASI_Hs01_00234743 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229405 predicted 517
2 SASI_Rn02_00229406 predicted 1264
3 SASI_Rn02_00229407 predicted 575
4 SASI_Rn02_00229408 predicted 1274
5 SASI_Rn02_00229409 predicted 437
6 SASI_Rn02_00229410 predicted 1200
7 SASI_Rn02_00229411 predicted 579
8 SASI_Rn02_00229412 predicted 1197
9 SASI_Rn02_00229413 predicted 415
10 SASI_Rn02_00229414 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178945 predicted 1838
2 SASI_Mm01_00178946 predicted 1688
3 SASI_Mm01_00178947 predicted 761
4 SASI_Mm01_00178948 predicted 510
5 SASI_Mm01_00178949 predicted 887
6 SASI_Mm01_00178950 predicted 705
7 SASI_Mm01_00178951 predicted 1007
8 SASI_Mm01_00178952 predicted 432
9 SASI_Mm01_00178953 predicted 1698
10 SASI_Mm01_00178954 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107791 predicted 1706
2 SASI_Mm01_00107792 predicted 1559
3 SASI_Mm01_00107793 predicted 757
4 SASI_Mm01_00107794 predicted 505
5 SASI_Mm01_00107795 predicted 874
6 SASI_Mm01_00107796 predicted 694
7 SASI_Mm01_00107797 predicted 1001
8 SASI_Mm01_00107798 predicted 427
9 SASI_Mm01_00107799 predicted 1566
10 SASI_Mm01_00107800 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004714
DYRK1B MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004714.1-2052s1c1
Sequence:CCGGCCCTCCGGACTCGGATGACTGCTCGAGCAGTCATCCGAGTCCGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004714.1-547s1c1
Sequence:CCGGCCATGGTTATGATGACGACAACTCGAGTTGTCGTCATCATAACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004714.x-442s1c1
Sequence:CCGGGACCTACAAGCACATCAATGACTCGAGTCATTGATGTGCTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004714.x-778s1c1
Sequence:CCGGCACGGAGATGAAGTACTATATCTCGAGATATAGTACTTCATCTCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004714.x-1353s1c1
Sequence:CCGGGAAGGACGAAAGAACTCAGGACTCGAGTCCTGAGTTCTTTCGTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-831s21c1
Sequence:CCGGACCACCTGTGCCTGGTATTTGCTCGAGCAAATACCAGGCACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-779s21c1
Sequence:CCGGACGGAGATGAAGTACTATATACTCGAGTATATAGTACTTCATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-1728s21c1
Sequence:CCGGACCGCTACAGCAACCGATATTCTCGAGAATATCGGTTGCTGTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-612s21c1
Sequence:CCGGACGAAATTGACTCGCTCATTGCTCGAGCAATGAGCGAGTCAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004714
DYRK1B MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004714.1-2052s1c1
Sequence:CCGGCCCTCCGGACTCGGATGACTGCTCGAGCAGTCATCCGAGTCCGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004714.1-547s1c1
Sequence:CCGGCCATGGTTATGATGACGACAACTCGAGTTGTCGTCATCATAACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004714.x-442s1c1
Sequence:CCGGGACCTACAAGCACATCAATGACTCGAGTCATTGATGTGCTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004714.x-778s1c1
Sequence:CCGGCACGGAGATGAAGTACTATATCTCGAGATATAGTACTTCATCTCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004714.x-1353s1c1
Sequence:CCGGGAAGGACGAAAGAACTCAGGACTCGAGTCCTGAGTTCTTTCGTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-831s21c1
Sequence:CCGGACCACCTGTGCCTGGTATTTGCTCGAGCAAATACCAGGCACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-779s21c1
Sequence:CCGGACGGAGATGAAGTACTATATACTCGAGTATATAGTACTTCATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-1728s21c1
Sequence:CCGGACCGCTACAGCAACCGATATTCTCGAGAATATCGGTTGCTGTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-612s21c1
Sequence:CCGGACGAAATTGACTCGCTCATTGCTCGAGCAATGAGCGAGTCAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004714
DYRK1B MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004714.1-2052s1c1
Sequence:CCGGCCCTCCGGACTCGGATGACTGCTCGAGCAGTCATCCGAGTCCGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004714.1-547s1c1
Sequence:CCGGCCATGGTTATGATGACGACAACTCGAGTTGTCGTCATCATAACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004714.x-442s1c1
Sequence:CCGGGACCTACAAGCACATCAATGACTCGAGTCATTGATGTGCTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004714.x-778s1c1
Sequence:CCGGCACGGAGATGAAGTACTATATCTCGAGATATAGTACTTCATCTCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004714.x-1353s1c1
Sequence:CCGGGAAGGACGAAAGAACTCAGGACTCGAGTCCTGAGTTCTTTCGTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-831s21c1
Sequence:CCGGACCACCTGTGCCTGGTATTTGCTCGAGCAAATACCAGGCACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-779s21c1
Sequence:CCGGACGGAGATGAAGTACTATATACTCGAGTATATAGTACTTCATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-1728s21c1
Sequence:CCGGACCGCTACAGCAACCGATATTCTCGAGAATATCGGTTGCTGTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004714.1-612s21c1
Sequence:CCGGACGAAATTGACTCGCTCATTGCTCGAGCAATGAGCGAGTCAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010092
VALIDATED
DYRK1B MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-577s1c1
Sequence:CCGGGCTATGAGATTGACTCTCTTACTCGAGTAAGAGAGTCAATCTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010092.1-1049s1c1
Sequence:CCGGCCAGCGGATCTACCAGTATATCTCGAGATATACTGGTAGATCCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-1574s1c1
Sequence:CCGGCTACCGATACAGCAACCGATACTCGAGTATCGGTTGCTGTATCGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-737s1c1
Sequence:CCGGCCAGCATGATACAGAGATGAACTCGAGTTCATCTCTGTATCATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-515s1c1
Sequence:CCGGCCACGGTTATGATGACGACAACTCGAGTTGTCGTCATCATAACCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-421s21c1
Sequence:CCGGACATCAATGAGGTATACTATGCTCGAGCATAGTATACCTCATTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-704s21c1
Sequence:CCGGACAGATTGAGCTACGGCTGTTCTCGAGAACAGCCGTAGCTCAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-759s21c1
Sequence:CCGGTACTACATAGTACACCTTAAGCTCGAGCTTAAGGTGTACTATGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1350s21c1
Sequence:CCGGGTGCTGCGCATGCTGGAATATCTCGAGATATTCCAGCATGCGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1203s21c1
Sequence:CCGGGTGGACCAGATGAGCCGTATTCTCGAGAATACGGCTCATCTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1117s21c1
Sequence:CCGGATGACCTGGCCATTGACATGTCTCGAGACATGTCAATGGCCAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-799s21c1
Sequence:CCGGATCACCTGTGCCTGGTGTTTGCTCGAGCAAACACCAGGCACAGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1270s21c1
Sequence:CCGGCCAAGGCTCGAAAGTACTTTGCTCGAGCAAAGTACTTTCGAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1713s21c1
Sequence:CCGGCCTATCTCTGCCTCAACATTGCTCGAGCAATGTTGAGGCAGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010092
VALIDATED
DYRK1B MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-577s1c1
Sequence:CCGGGCTATGAGATTGACTCTCTTACTCGAGTAAGAGAGTCAATCTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010092.1-1049s1c1
Sequence:CCGGCCAGCGGATCTACCAGTATATCTCGAGATATACTGGTAGATCCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-1574s1c1
Sequence:CCGGCTACCGATACAGCAACCGATACTCGAGTATCGGTTGCTGTATCGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-737s1c1
Sequence:CCGGCCAGCATGATACAGAGATGAACTCGAGTTCATCTCTGTATCATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-515s1c1
Sequence:CCGGCCACGGTTATGATGACGACAACTCGAGTTGTCGTCATCATAACCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-421s21c1
Sequence:CCGGACATCAATGAGGTATACTATGCTCGAGCATAGTATACCTCATTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-704s21c1
Sequence:CCGGACAGATTGAGCTACGGCTGTTCTCGAGAACAGCCGTAGCTCAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-759s21c1
Sequence:CCGGTACTACATAGTACACCTTAAGCTCGAGCTTAAGGTGTACTATGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1350s21c1
Sequence:CCGGGTGCTGCGCATGCTGGAATATCTCGAGATATTCCAGCATGCGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1203s21c1
Sequence:CCGGGTGGACCAGATGAGCCGTATTCTCGAGAATACGGCTCATCTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1117s21c1
Sequence:CCGGATGACCTGGCCATTGACATGTCTCGAGACATGTCAATGGCCAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-799s21c1
Sequence:CCGGATCACCTGTGCCTGGTGTTTGCTCGAGCAAACACCAGGCACAGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1270s21c1
Sequence:CCGGCCAAGGCTCGAAAGTACTTTGCTCGAGCAAAGTACTTTCGAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1713s21c1
Sequence:CCGGCCTATCTCTGCCTCAACATTGCTCGAGCAATGTTGAGGCAGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010092
VALIDATED
DYRK1B MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-577s1c1
Sequence:CCGGGCTATGAGATTGACTCTCTTACTCGAGTAAGAGAGTCAATCTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010092.1-1049s1c1
Sequence:CCGGCCAGCGGATCTACCAGTATATCTCGAGATATACTGGTAGATCCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-1574s1c1
Sequence:CCGGCTACCGATACAGCAACCGATACTCGAGTATCGGTTGCTGTATCGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-737s1c1
Sequence:CCGGCCAGCATGATACAGAGATGAACTCGAGTTCATCTCTGTATCATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010092.1-515s1c1
Sequence:CCGGCCACGGTTATGATGACGACAACTCGAGTTGTCGTCATCATAACCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-421s21c1
Sequence:CCGGACATCAATGAGGTATACTATGCTCGAGCATAGTATACCTCATTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-704s21c1
Sequence:CCGGACAGATTGAGCTACGGCTGTTCTCGAGAACAGCCGTAGCTCAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-759s21c1
Sequence:CCGGTACTACATAGTACACCTTAAGCTCGAGCTTAAGGTGTACTATGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1350s21c1
Sequence:CCGGGTGCTGCGCATGCTGGAATATCTCGAGATATTCCAGCATGCGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1203s21c1
Sequence:CCGGGTGGACCAGATGAGCCGTATTCTCGAGAATACGGCTCATCTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1117s21c1
Sequence:CCGGATGACCTGGCCATTGACATGTCTCGAGACATGTCAATGGCCAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-799s21c1
Sequence:CCGGATCACCTGTGCCTGGTGTTTGCTCGAGCAAACACCAGGCACAGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1270s21c1
Sequence:CCGGCCAAGGCTCGAAAGTACTTTGCTCGAGCAAAGTACTTTCGAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010092.1-1713s21c1
Sequence:CCGGCCTATCTCTGCCTCAACATTGCTCGAGCAATGTTGAGGCAGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks