EMAIL THIS PAGE TO A FRIEND

DYRK2

dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2

170 Gene Product Result for
UniProtKB ID: Q92630, B2R9V9, Q9BRB5
Gene ID:
Human(8445) Summary: DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]
Mouse(69181) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Rat(314862) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
sheep(101107511) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
naked mole-rat(101701080) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
domestic guinea pig(100734657) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Zebrafish(557602) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
dog(481152) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
cow(514916) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
domestic cat(101094686) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
chicken(427864) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003583 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_483957 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_483957 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_483957 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003583 Rosetta Predictions human pricing
NM_006482 Rosetta Predictions human pricing
NM_001108100 Rosetta Predictions rat pricing
NM_001014390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076612 predicted 1973
2 SASI_Hs01_00076613 predicted 1390
3 SASI_Hs01_00076614 predicted 1083
4 SASI_Hs01_00076615 predicted 1229
5 SASI_Hs01_00076616 predicted 845
6 SASI_Hs01_00076617 predicted 705
7 SASI_Hs01_00076618 predicted 1162
8 SASI_Hs01_00076619 predicted 1377
9 SASI_Hs01_00076620 predicted 2143
10 SASI_Hs01_00076621 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125774 predicted 2129
2 SASI_Hs01_00125775 predicted 1536
3 SASI_Hs01_00125776 predicted 1233
4 SASI_Hs01_00125777 predicted 1371
5 SASI_Hs01_00125778 predicted 988
6 SASI_Hs01_00125779 predicted 854
7 SASI_Hs01_00125780 predicted 1311
8 SASI_Hs01_00125781 predicted 1531
9 SASI_Hs01_00125782 predicted 2292
10 SASI_Hs01_00125783 predicted 1479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235354 predicted 683
2 SASI_Rn02_00235355 predicted 363
3 SASI_Rn02_00235356 predicted 1634
4 SASI_Rn02_00235357 predicted 1145
5 SASI_Rn02_00235358 predicted 1530
6 SASI_Rn02_00235359 predicted 997
7 SASI_Rn02_00235360 predicted 770
8 SASI_Rn02_00235361 predicted 771
9 SASI_Rn02_00235362 predicted 325
10 SASI_Rn02_00235363 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043154 predicted 1097
2 SASI_Mm01_00043155 predicted 1261
3 SASI_Mm01_00043156 predicted 1725
4 SASI_Mm01_00043157 predicted 1220
5 SASI_Mm01_00043158 predicted 1414
6 SASI_Mm01_00043159 predicted 1521
7 SASI_Mm01_00043160 predicted 588
8 SASI_Mm01_00043161 predicted 1047
9 SASI_Mm01_00043163 predicted 1219
10 SASI_Mm02_00287418 predicted 603
11 SASI_Mm01_00043162 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003583
DYRK2 MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003583.3-1447s1c1
Sequence:CCGGGTATGGCATGCCCATTGATATCTCGAGATATCAATGGGCATGCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003583.x-1739s1c1
Sequence:CCGGGAGGACTAATTTGGCGCAGATCTCGAGATCTGCGCCAAATTAGTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003583.x-836s1c1
Sequence:CCGGGCAGGACAAGGATAACACAATCTCGAGATTGTGTTATCCTTGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003583.x-2863s1c1
Sequence:CCGGCCTGGGAAACTATCAACTCTTCTCGAGAAGAGTTGATAGTTTCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003583.2-2716s1c1
Sequence:CCGGGCTGTGATTATGACCATTGTTCTCGAGAACAATGGTCATAATCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003583.2-1702s1c1
Sequence:CCGGCCAAGTTACCTCCACCTTCTACTCGAGTAGAAGGTGGAGGTAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003583.2-2409s1c1
Sequence:CCGGCCAGTTAGCATTCTGACATTCCTCGAGGAATGTCAGAATGCTAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003583
DYRK2 MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003583.3-1447s1c1
Sequence:CCGGGTATGGCATGCCCATTGATATCTCGAGATATCAATGGGCATGCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003583.x-1739s1c1
Sequence:CCGGGAGGACTAATTTGGCGCAGATCTCGAGATCTGCGCCAAATTAGTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003583.x-836s1c1
Sequence:CCGGGCAGGACAAGGATAACACAATCTCGAGATTGTGTTATCCTTGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003583.x-2863s1c1
Sequence:CCGGCCTGGGAAACTATCAACTCTTCTCGAGAAGAGTTGATAGTTTCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003583.2-2716s1c1
Sequence:CCGGGCTGTGATTATGACCATTGTTCTCGAGAACAATGGTCATAATCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003583.2-1702s1c1
Sequence:CCGGCCAAGTTACCTCCACCTTCTACTCGAGTAGAAGGTGGAGGTAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003583.2-2409s1c1
Sequence:CCGGCCAGTTAGCATTCTGACATTCCTCGAGGAATGTCAGAATGCTAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003583
DYRK2 MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003583.3-1447s1c1
Sequence:CCGGGTATGGCATGCCCATTGATATCTCGAGATATCAATGGGCATGCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003583.x-1739s1c1
Sequence:CCGGGAGGACTAATTTGGCGCAGATCTCGAGATCTGCGCCAAATTAGTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003583.x-836s1c1
Sequence:CCGGGCAGGACAAGGATAACACAATCTCGAGATTGTGTTATCCTTGTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003583.x-2863s1c1
Sequence:CCGGCCTGGGAAACTATCAACTCTTCTCGAGAAGAGTTGATAGTTTCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003583.2-2716s1c1
Sequence:CCGGGCTGTGATTATGACCATTGTTCTCGAGAACAATGGTCATAATCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003583.2-1702s1c1
Sequence:CCGGCCAAGTTACCTCCACCTTCTACTCGAGTAGAAGGTGGAGGTAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003583.2-2409s1c1
Sequence:CCGGCCAGTTAGCATTCTGACATTCCTCGAGGAATGTCAGAATGCTAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_483957
VALIDATED
DYRK2 MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-861s1c1
Sequence:CCGGGCTTTGCACAAGAACAGAATACTCGAGTATTCTGTTCTTGTGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-325s1c1
Sequence:CCGGCGATGAAGCAATACATGCAAACTCGAGTTTGCATGTATTGCTTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_483957.2-923s1c1
Sequence:CCGGGCAGGGTCGAAGCAGTATTAACTCGAGTTAATACTGCTTCGACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-354s1c1
Sequence:CCGGGCCTTCGAACACCATGAGATTCTCGAGAATCTCATGGTGTTCGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-851s1c1
Sequence:CCGGGTGCTTGGATGCTTTGCACAACTCGAGTTGTGCAAAGCATCCAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_483957
VALIDATED
DYRK2 MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-861s1c1
Sequence:CCGGGCTTTGCACAAGAACAGAATACTCGAGTATTCTGTTCTTGTGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-325s1c1
Sequence:CCGGCGATGAAGCAATACATGCAAACTCGAGTTTGCATGTATTGCTTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_483957.2-923s1c1
Sequence:CCGGGCAGGGTCGAAGCAGTATTAACTCGAGTTAATACTGCTTCGACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-354s1c1
Sequence:CCGGGCCTTCGAACACCATGAGATTCTCGAGAATCTCATGGTGTTCGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-851s1c1
Sequence:CCGGGTGCTTGGATGCTTTGCACAACTCGAGTTGTGCAAAGCATCCAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_483957
VALIDATED
DYRK2 MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-861s1c1
Sequence:CCGGGCTTTGCACAAGAACAGAATACTCGAGTATTCTGTTCTTGTGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-325s1c1
Sequence:CCGGCGATGAAGCAATACATGCAAACTCGAGTTTGCATGTATTGCTTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_483957.2-923s1c1
Sequence:CCGGGCAGGGTCGAAGCAGTATTAACTCGAGTTAATACTGCTTCGACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-354s1c1
Sequence:CCGGGCCTTCGAACACCATGAGATTCTCGAGAATCTCATGGTGTTCGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_483957.2-851s1c1
Sequence:CCGGGTGCTTGGATGCTTTGCACAACTCGAGTTGTGCAAAGCATCCAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)