EMAIL THIS PAGE TO A FRIEND

DYRK3

dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3

91 Gene Product Result for
Synonyms: DYRK5 RED REDK hYAK3-2
UniProtKB ID: O43781, D3DT79, Q7Z752, Q9HBY6, Q9HBY7
Gene ID:
Human(8444) Summary: This gene product belongs to the DYRK family of dual-specificity protein kinases that catalyze autophosphorylation on serine/threonine and tyrosine residues. The members of this family share structural similarity, however, differ in their substrate specificity, suggesting their involvement in different cellular functions. The encoded protein has been shown to autophosphorylate on tyrosine residue and catalyze phosphorylation of histones H3 and H2B in vitro. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(226419) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Rat(304775) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
fruit fly(3885567) CG40478 gene product from transcript CG40478-RE
domestic cat(101091077) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
cow(505149) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
dog(480010) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
chicken(419846) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
domestic guinea pig(100715438) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
naked mole-rat(101726350) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
sheep(101117860) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003582 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004023 Rosetta Predictions human pricing
NM_003582 Rosetta Predictions human pricing
NM_001024767 Rosetta Predictions rat pricing
NM_145508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165903 predicted 1713
2 SASI_Hs01_00165904 predicted 932
3 SASI_Hs01_00165905 predicted 800
4 SASI_Hs01_00165906 predicted 548
5 SASI_Hs01_00165907 predicted 1812
6 SASI_Hs02_00304442 predicted 1377
7 SASI_Hs01_00165909 predicted 1723
8 SASI_Hs01_00165910 predicted 2032
9 SASI_Hs01_00165911 predicted 1996
10 SASI_Hs01_00165912 predicted 684
11 SASI_Hs01_00165908 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144739 predicted 1616
2 SASI_Hs01_00144740 predicted 837
3 SASI_Hs01_00144741 predicted 708
4 SASI_Hs01_00144742 predicted 457
5 SASI_Hs01_00144743 predicted 1726
6 SASI_Hs02_00335898 predicted 1280
7 SASI_Hs01_00144745 predicted 1629
8 SASI_Hs01_00144746 predicted 1940
9 SASI_Hs01_00144747 predicted 1902
10 SASI_Hs01_00144748 predicted 597
11 SASI_Hs01_00144744 predicted 1787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202648 predicted 635
2 SASI_Rn01_00044948 predicted 201
3 SASI_Rn01_00044949 predicted 516
4 SASI_Rn01_00044950 predicted 1378
5 SASI_Rn01_00044951 predicted 1276
6 SASI_Rn01_00044952 predicted 1584
7 SASI_Rn01_00044953 predicted 299
8 SASI_Rn02_00202649 predicted 548
9 SASI_Rn01_00044955 predicted 256
10 SASI_Rn02_00202650 predicted 639
11 SASI_Rn01_00044954 predicted 1300
12 SASI_Rn01_00044956 predicted 1666
13 SASI_Rn01_00044957 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164191 predicted 364
2 SASI_Mm01_00164192 predicted 604
3 SASI_Mm01_00164193 predicted 1546
4 SASI_Mm01_00164195 predicted 1506
5 SASI_Mm01_00164196 predicted 469
6 SASI_Mm02_00340955 predicted 1244
7 SASI_Mm01_00164197 predicted 1238
8 SASI_Mm01_00164198 predicted 1341
9 SASI_Mm01_00164199 predicted 253
10 SASI_Mm02_00340956 predicted 339
11 SASI_Mm01_00164194 predicted 329
12 SASI_Mm01_00164200 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003582
VALIDATED
DYRK3 MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-2008s1c1
Sequence:CCGGGCAAGCCCATTGGTGGATGTTCTCGAGAACATCCACCAATGGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-1776s1c1
Sequence:CCGGGTCAGGGAAACGGGTAGTTAACTCGAGTTAACTACCCGTTTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-1847s1c1
Sequence:CCGGGAATAGCCAATAAGCTTAAAGCTCGAGCTTTAAGCTTATTGGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-1880s1c1
Sequence:CCGGCAGAAACCAATGGTAGTATACCTCGAGGTATACTACCATTGGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003582.2-2009s1c1
Sequence:CCGGCAAGCCCATTGGTGGATGTTTCTCGAGAAACATCCACCAATGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.x-1765s1c1
Sequence:CCGGCGGGTAGTTAATCCTGCAAGTCTCGAGACTTGCAGGATTAACTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003582.x-1956s1c1
Sequence:CCGGATGATCTTACAAACCTGCAAACTCGAGTTTGCAGGTTTGTAAGATCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.x-817s1c1
Sequence:CCGGGCCAGGGTCTATGATCACAAACTCGAGTTTGTGATCATAGACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003582.x-658s1c1
Sequence:CCGGGTAGGTCCAAATGCCAAGAAACTCGAGTTTCTTGGCATTTGGACCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003582.x-283s1c1
Sequence:CCGGTGTTCAAATGTACTCTGCAATCTCGAGATTGCAGAGTACATTTGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-1325s21c1
Sequence:GTACCGGACAGCACACCAATTGACATATCTCGAGATATGTCAATTGGTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003582.2-838s21c1
Sequence:CCGGGCCAGGGTCTATGATCACAAACTCGAGTTTGTGATCATAGACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003582.2-1978s21c1
Sequence:CCGGTGATCTTACAAACCTGCAAATCTCGAGATTTGCAGGTTTGTAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-1475s21c1
Sequence:CCGGCCAAACGTGCCAAGTACTTTACTCGAGTAAAGTACTTGGCACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-1048s21c1
Sequence:CCGGGACCTTTATGAGCTGATTAAACTCGAGTTTAATCAGCTCATAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-775s21c1
Sequence:CCGGGACCATCTAGCTTATCGATATCTCGAGATATCGATAAGCTAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003582
VALIDATED
DYRK3 MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-2008s1c1
Sequence:CCGGGCAAGCCCATTGGTGGATGTTCTCGAGAACATCCACCAATGGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-1776s1c1
Sequence:CCGGGTCAGGGAAACGGGTAGTTAACTCGAGTTAACTACCCGTTTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-1847s1c1
Sequence:CCGGGAATAGCCAATAAGCTTAAAGCTCGAGCTTTAAGCTTATTGGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-1880s1c1
Sequence:CCGGCAGAAACCAATGGTAGTATACCTCGAGGTATACTACCATTGGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003582.2-2009s1c1
Sequence:CCGGCAAGCCCATTGGTGGATGTTTCTCGAGAAACATCCACCAATGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.x-1765s1c1
Sequence:CCGGCGGGTAGTTAATCCTGCAAGTCTCGAGACTTGCAGGATTAACTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003582.x-1956s1c1
Sequence:CCGGATGATCTTACAAACCTGCAAACTCGAGTTTGCAGGTTTGTAAGATCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.x-817s1c1
Sequence:CCGGGCCAGGGTCTATGATCACAAACTCGAGTTTGTGATCATAGACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003582.x-658s1c1
Sequence:CCGGGTAGGTCCAAATGCCAAGAAACTCGAGTTTCTTGGCATTTGGACCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003582.x-283s1c1
Sequence:CCGGTGTTCAAATGTACTCTGCAATCTCGAGATTGCAGAGTACATTTGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-1325s21c1
Sequence:GTACCGGACAGCACACCAATTGACATATCTCGAGATATGTCAATTGGTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003582.2-838s21c1
Sequence:CCGGGCCAGGGTCTATGATCACAAACTCGAGTTTGTGATCATAGACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003582.2-1978s21c1
Sequence:CCGGTGATCTTACAAACCTGCAAATCTCGAGATTTGCAGGTTTGTAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-1475s21c1
Sequence:CCGGCCAAACGTGCCAAGTACTTTACTCGAGTAAAGTACTTGGCACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-1048s21c1
Sequence:CCGGGACCTTTATGAGCTGATTAAACTCGAGTTTAATCAGCTCATAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-775s21c1
Sequence:CCGGGACCATCTAGCTTATCGATATCTCGAGATATCGATAAGCTAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003582
VALIDATED
DYRK3 MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-2008s1c1
Sequence:CCGGGCAAGCCCATTGGTGGATGTTCTCGAGAACATCCACCAATGGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-1776s1c1
Sequence:CCGGGTCAGGGAAACGGGTAGTTAACTCGAGTTAACTACCCGTTTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-1847s1c1
Sequence:CCGGGAATAGCCAATAAGCTTAAAGCTCGAGCTTTAAGCTTATTGGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.2-1880s1c1
Sequence:CCGGCAGAAACCAATGGTAGTATACCTCGAGGTATACTACCATTGGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003582.2-2009s1c1
Sequence:CCGGCAAGCCCATTGGTGGATGTTTCTCGAGAAACATCCACCAATGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.x-1765s1c1
Sequence:CCGGCGGGTAGTTAATCCTGCAAGTCTCGAGACTTGCAGGATTAACTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003582.x-1956s1c1
Sequence:CCGGATGATCTTACAAACCTGCAAACTCGAGTTTGCAGGTTTGTAAGATCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003582.x-817s1c1
Sequence:CCGGGCCAGGGTCTATGATCACAAACTCGAGTTTGTGATCATAGACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003582.x-658s1c1
Sequence:CCGGGTAGGTCCAAATGCCAAGAAACTCGAGTTTCTTGGCATTTGGACCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003582.x-283s1c1
Sequence:CCGGTGTTCAAATGTACTCTGCAATCTCGAGATTGCAGAGTACATTTGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-1325s21c1
Sequence:GTACCGGACAGCACACCAATTGACATATCTCGAGATATGTCAATTGGTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003582.2-838s21c1
Sequence:CCGGGCCAGGGTCTATGATCACAAACTCGAGTTTGTGATCATAGACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003582.2-1978s21c1
Sequence:CCGGTGATCTTACAAACCTGCAAATCTCGAGATTTGCAGGTTTGTAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-1475s21c1
Sequence:CCGGCCAAACGTGCCAAGTACTTTACTCGAGTAAAGTACTTGGCACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-1048s21c1
Sequence:CCGGGACCTTTATGAGCTGATTAAACTCGAGTTTAATCAGCTCATAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003582.2-775s21c1
Sequence:CCGGGACCATCTAGCTTATCGATATCTCGAGATATCGATAAGCTAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145508
VALIDATED
DYRK3 MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1330s1c1
Sequence:CCGGGCCTGCATGATAGAGTTGCTACTCGAGTAGCAACTCTATCATGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1689s1c1
Sequence:CCGGGCGGGTAGTTAACCCTACAAACTCGAGTTTGTAGGGTTAACTACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-207s1c1
Sequence:CCGGCCCACCCTATTCGGACACATTCTCGAGAATGTGTCCGAATAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1621s1c1
Sequence:CCGGGCATTAAGACATCCTTGGATTCTCGAGAATCCAAGGATGTCTTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1154s1c1
Sequence:CCGGGCTTCGAGTATCAGAAGCTTTCTCGAGAAAGCTTCTGATACTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1382s21c1
Sequence:CCGGCCAAGCGTGCCAAGTACTTTACTCGAGTAAAGTACTTGGCACGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145508.2-954s21c1
Sequence:CCGGAGACCTGTATGAGCTTATTAACTCGAGTTAATAAGCTCATACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1783s21c1
Sequence:CCGGTCCGAAACCAGTGGTAGTATACTCGAGTATACTACCACTGGTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1846s21c1
Sequence:CCGGACTCAGAGACTGATACATATCCTCGAGGATATGTATCAGTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145508.2-1690s21c1
Sequence:CCGGCGGGTAGTTAACCCTACAAATCTCGAGATTTGTAGGGTTAACTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1550s21c1
Sequence:CCGGACTACTTGTTCATAGAGTTTCCTCGAGGAAACTCTATGAACAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145508.2-508s21c1
Sequence:CCGGCAAGCGCTGAAGCAGTATAAACTCGAGTTTATACTGCTTCAGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1164s21c1
Sequence:CCGGTCAGAAGCTTTACACGTATATCTCGAGATATACGTGTAAAGCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145508
VALIDATED
DYRK3 MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1330s1c1
Sequence:CCGGGCCTGCATGATAGAGTTGCTACTCGAGTAGCAACTCTATCATGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1689s1c1
Sequence:CCGGGCGGGTAGTTAACCCTACAAACTCGAGTTTGTAGGGTTAACTACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-207s1c1
Sequence:CCGGCCCACCCTATTCGGACACATTCTCGAGAATGTGTCCGAATAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1621s1c1
Sequence:CCGGGCATTAAGACATCCTTGGATTCTCGAGAATCCAAGGATGTCTTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1154s1c1
Sequence:CCGGGCTTCGAGTATCAGAAGCTTTCTCGAGAAAGCTTCTGATACTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1382s21c1
Sequence:CCGGCCAAGCGTGCCAAGTACTTTACTCGAGTAAAGTACTTGGCACGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145508.2-954s21c1
Sequence:CCGGAGACCTGTATGAGCTTATTAACTCGAGTTAATAAGCTCATACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1783s21c1
Sequence:CCGGTCCGAAACCAGTGGTAGTATACTCGAGTATACTACCACTGGTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1846s21c1
Sequence:CCGGACTCAGAGACTGATACATATCCTCGAGGATATGTATCAGTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145508.2-1690s21c1
Sequence:CCGGCGGGTAGTTAACCCTACAAATCTCGAGATTTGTAGGGTTAACTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1550s21c1
Sequence:CCGGACTACTTGTTCATAGAGTTTCCTCGAGGAAACTCTATGAACAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145508.2-508s21c1
Sequence:CCGGCAAGCGCTGAAGCAGTATAAACTCGAGTTTATACTGCTTCAGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1164s21c1
Sequence:CCGGTCAGAAGCTTTACACGTATATCTCGAGATATACGTGTAAAGCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145508
VALIDATED
DYRK3 MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1330s1c1
Sequence:CCGGGCCTGCATGATAGAGTTGCTACTCGAGTAGCAACTCTATCATGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1689s1c1
Sequence:CCGGGCGGGTAGTTAACCCTACAAACTCGAGTTTGTAGGGTTAACTACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-207s1c1
Sequence:CCGGCCCACCCTATTCGGACACATTCTCGAGAATGTGTCCGAATAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1621s1c1
Sequence:CCGGGCATTAAGACATCCTTGGATTCTCGAGAATCCAAGGATGTCTTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145508.1-1154s1c1
Sequence:CCGGGCTTCGAGTATCAGAAGCTTTCTCGAGAAAGCTTCTGATACTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1382s21c1
Sequence:CCGGCCAAGCGTGCCAAGTACTTTACTCGAGTAAAGTACTTGGCACGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145508.2-954s21c1
Sequence:CCGGAGACCTGTATGAGCTTATTAACTCGAGTTAATAAGCTCATACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1783s21c1
Sequence:CCGGTCCGAAACCAGTGGTAGTATACTCGAGTATACTACCACTGGTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1846s21c1
Sequence:CCGGACTCAGAGACTGATACATATCCTCGAGGATATGTATCAGTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145508.2-1690s21c1
Sequence:CCGGCGGGTAGTTAACCCTACAAATCTCGAGATTTGTAGGGTTAACTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1550s21c1
Sequence:CCGGACTACTTGTTCATAGAGTTTCCTCGAGGAAACTCTATGAACAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145508.2-508s21c1
Sequence:CCGGCAAGCGCTGAAGCAGTATAAACTCGAGTTTATACTGCTTCAGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145508.2-1164s21c1
Sequence:CCGGTCAGAAGCTTTACACGTATATCTCGAGATATACGTGTAAAGCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks