EMAIL THIS PAGE TO A FRIEND

DYRK4

dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4

92 Gene Product Result for
UniProtKB ID: Q9NR20, Q8NEF2, Q92631
Gene ID:
Human(8798) Summary: Dual-specificity kinases, such as DYRK4, play key roles in cell proliferation, survival, and development (Zhang et al., 2005 [PubMed 15607427]
Mouse(101320) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Rat(312721) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
sheep(101111959) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
domestic guinea pig(100718077) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Zebrafish(564976) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
cow(531276) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
domestic cat(101100313) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
dog(477720) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003845 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003845 Rosetta Predictions human pricing
XM_232364 Rosetta Predictions rat pricing
NM_207210 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239803 predicted 425
2 SASI_Hs01_00239804 predicted 1404
3 SASI_Hs01_00239805 predicted 916
4 SASI_Hs01_00239806 predicted 1527
5 SASI_Hs01_00239807 predicted 838
6 SASI_Hs01_00239808 predicted 1529
7 SASI_Hs02_00336417 predicted 1487
8 SASI_Hs01_00239810 predicted 944
9 SASI_Hs01_00239811 predicted 921
10 SASI_Hs02_00336418 predicted 1482
11 SASI_Hs01_00239802 predicted 736
12 SASI_Hs01_00239809 predicted 1590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387120 predicted 1754
2 SASI_Rn02_00387121 predicted 715
3 SASI_Rn02_00387122 predicted 1746
4 SASI_Rn02_00387123 predicted 1606
5 SASI_Rn02_00387124 predicted 1797
6 SASI_Rn02_00387125 predicted 983
7 SASI_Rn02_00387126 predicted 1845
8 SASI_Rn02_00387127 predicted 1068
9 SASI_Rn02_00387128 predicted 1172
10 SASI_Rn02_00387129 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080079 predicted 937
2 SASI_Mm01_00080080 predicted 1786
3 SASI_Mm02_00351933 predicted 1633
4 SASI_Mm01_00080081 predicted 1209
5 SASI_Mm01_00080082 predicted 389
6 SASI_Mm01_00080083 predicted 1235
7 SASI_Mm01_00080084 predicted 1243
8 SASI_Mm01_00080085 predicted 1092
9 SASI_Mm01_00080086 predicted 1009
10 SASI_Mm01_00080087 predicted 288
11 SASI_Mm01_00080088 predicted 1698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003845
VALIDATED
DYRK4 MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-193s21c1
Sequence:CCGGACCTTTCCACCCTAGCATTAACTCGAGTTAATGCTAGGGTGGAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-909s21c1
Sequence:CCGGACTTTGGATCAAGCTGTTATGCTCGAGCATAACAGCTTGATCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-1603s21c1
Sequence:CCGGACTGGTAGACGCTCCCAAGAACTCGAGTTCTTGGGAGCGTCTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-762s21c1
Sequence:CCGGGCTTCAGTCTGTCCATAGTTCCTCGAGGAACTATGGACAGACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003845.x-1755s1c1
Sequence:CCGGACCAGTGATTTGTATTAAGACCTCGAGGTCTTAATACAAATCACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003845.x-949s1c1
Sequence:CCGGGTACATCCAAAGCCGGTTCTACTCGAGTAGAACCGGCTTTGGATGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.x-887s1c1
Sequence:CCGGCAAGCCTCTGTTAAAGTCATTCTCGAGAATGACTTTAACAGAGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003845.1-429s1c1
Sequence:CCGGGCTTCTATCTGAAGGTTCTGCCTCGAGGCAGAACCTTCAGATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-452s1c1
Sequence:CCGGGATCACATTGCCTACCGCTATCTCGAGATAGCGGTAGGCAATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-814s1c1
Sequence:CCGGGCAGATGCTTTCGGTAGAGAACTCGAGTTCTCTACCGAAAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_003845.1-1342s1c1
Sequence:CCGGCCTCAAGCATGCTTGGATTCACTCGAGTGAATCCAAGCATGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-934s1c1
Sequence:CCGGCCAGAAAGTATACACGTACATCTCGAGATGTACGTGTATACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-1163s1c1
Sequence:CCGGCAGACATTCTTTGATTCCAAACTCGAGTTTGGAATCAAAGAATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003845
VALIDATED
DYRK4 MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-193s21c1
Sequence:CCGGACCTTTCCACCCTAGCATTAACTCGAGTTAATGCTAGGGTGGAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-909s21c1
Sequence:CCGGACTTTGGATCAAGCTGTTATGCTCGAGCATAACAGCTTGATCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-1603s21c1
Sequence:CCGGACTGGTAGACGCTCCCAAGAACTCGAGTTCTTGGGAGCGTCTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-762s21c1
Sequence:CCGGGCTTCAGTCTGTCCATAGTTCCTCGAGGAACTATGGACAGACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003845.x-1755s1c1
Sequence:CCGGACCAGTGATTTGTATTAAGACCTCGAGGTCTTAATACAAATCACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003845.x-949s1c1
Sequence:CCGGGTACATCCAAAGCCGGTTCTACTCGAGTAGAACCGGCTTTGGATGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.x-887s1c1
Sequence:CCGGCAAGCCTCTGTTAAAGTCATTCTCGAGAATGACTTTAACAGAGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003845.1-429s1c1
Sequence:CCGGGCTTCTATCTGAAGGTTCTGCCTCGAGGCAGAACCTTCAGATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-452s1c1
Sequence:CCGGGATCACATTGCCTACCGCTATCTCGAGATAGCGGTAGGCAATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-814s1c1
Sequence:CCGGGCAGATGCTTTCGGTAGAGAACTCGAGTTCTCTACCGAAAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_003845.1-1342s1c1
Sequence:CCGGCCTCAAGCATGCTTGGATTCACTCGAGTGAATCCAAGCATGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-934s1c1
Sequence:CCGGCCAGAAAGTATACACGTACATCTCGAGATGTACGTGTATACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-1163s1c1
Sequence:CCGGCAGACATTCTTTGATTCCAAACTCGAGTTTGGAATCAAAGAATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003845
VALIDATED
DYRK4 MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-193s21c1
Sequence:CCGGACCTTTCCACCCTAGCATTAACTCGAGTTAATGCTAGGGTGGAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-909s21c1
Sequence:CCGGACTTTGGATCAAGCTGTTATGCTCGAGCATAACAGCTTGATCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-1603s21c1
Sequence:CCGGACTGGTAGACGCTCCCAAGAACTCGAGTTCTTGGGAGCGTCTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003845.1-762s21c1
Sequence:CCGGGCTTCAGTCTGTCCATAGTTCCTCGAGGAACTATGGACAGACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003845.x-1755s1c1
Sequence:CCGGACCAGTGATTTGTATTAAGACCTCGAGGTCTTAATACAAATCACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003845.x-949s1c1
Sequence:CCGGGTACATCCAAAGCCGGTTCTACTCGAGTAGAACCGGCTTTGGATGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.x-887s1c1
Sequence:CCGGCAAGCCTCTGTTAAAGTCATTCTCGAGAATGACTTTAACAGAGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003845.1-429s1c1
Sequence:CCGGGCTTCTATCTGAAGGTTCTGCCTCGAGGCAGAACCTTCAGATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-452s1c1
Sequence:CCGGGATCACATTGCCTACCGCTATCTCGAGATAGCGGTAGGCAATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-814s1c1
Sequence:CCGGGCAGATGCTTTCGGTAGAGAACTCGAGTTCTCTACCGAAAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_003845.1-1342s1c1
Sequence:CCGGCCTCAAGCATGCTTGGATTCACTCGAGTGAATCCAAGCATGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-934s1c1
Sequence:CCGGCCAGAAAGTATACACGTACATCTCGAGATGTACGTGTATACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003845.1-1163s1c1
Sequence:CCGGCAGACATTCTTTGATTCCAAACTCGAGTTTGGAATCAAAGAATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207210
DYRK4 MISSION shRNA Bacterial Glycerol Stock
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-743s21c1
Sequence:CCGGGACCACATTGCCTACCGATATCTCGAGATATCGGTAGGCAATGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-560s21c1
Sequence:CCGGACAGTAGCAGAGGCCCTAAAGCTCGAGCTTTAGGGCCTCTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-602s21c1
Sequence:CCGGCCTTATGAGCAAAGCGAAATCCTCGAGGATTTCGCTTTGCTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-1638s21c1
Sequence:CCGGGGATTCACGAGCCGAGGAAATCTCGAGATTTCCTCGGCTCGTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-1710s1c1
Sequence:CCGGCCTCTGAGATAAGCACGGAAACTCGAGTTTCCGTGCTTATCTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-572s1c1
Sequence:CCGGGCCCTAAAGTTCTTTAAGAATCTCGAGATTCTTAAAGAACTTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-1700s1c1
Sequence:CCGGGCCAGTATTTCCTCTGAGATACTCGAGTATCTCAGAGGAAATACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-1176s1c1
Sequence:CCGGGCCAAGTCACTGTTAAAGTTACTCGAGTAACTTTAACAGTGACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-271s1c1
Sequence:CCGGGCCATCCTCCAAGAACAAGAACTCGAGTTCTTGTTCTTGGAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207210
DYRK4 MISSION shRNA shRNA Plasmid DNA
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-743s21c1
Sequence:CCGGGACCACATTGCCTACCGATATCTCGAGATATCGGTAGGCAATGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-560s21c1
Sequence:CCGGACAGTAGCAGAGGCCCTAAAGCTCGAGCTTTAGGGCCTCTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-602s21c1
Sequence:CCGGCCTTATGAGCAAAGCGAAATCCTCGAGGATTTCGCTTTGCTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-1638s21c1
Sequence:CCGGGGATTCACGAGCCGAGGAAATCTCGAGATTTCCTCGGCTCGTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-1710s1c1
Sequence:CCGGCCTCTGAGATAAGCACGGAAACTCGAGTTTCCGTGCTTATCTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-572s1c1
Sequence:CCGGGCCCTAAAGTTCTTTAAGAATCTCGAGATTCTTAAAGAACTTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-1700s1c1
Sequence:CCGGGCCAGTATTTCCTCTGAGATACTCGAGTATCTCAGAGGAAATACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-1176s1c1
Sequence:CCGGGCCAAGTCACTGTTAAAGTTACTCGAGTAACTTTAACAGTGACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-271s1c1
Sequence:CCGGGCCATCCTCCAAGAACAAGAACTCGAGTTCTTGTTCTTGGAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207210
DYRK4 MISSION shRNA Lentiviral Transduction Particles
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-743s21c1
Sequence:CCGGGACCACATTGCCTACCGATATCTCGAGATATCGGTAGGCAATGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-560s21c1
Sequence:CCGGACAGTAGCAGAGGCCCTAAAGCTCGAGCTTTAGGGCCTCTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-602s21c1
Sequence:CCGGCCTTATGAGCAAAGCGAAATCCTCGAGGATTTCGCTTTGCTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207210.1-1638s21c1
Sequence:CCGGGGATTCACGAGCCGAGGAAATCTCGAGATTTCCTCGGCTCGTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-1710s1c1
Sequence:CCGGCCTCTGAGATAAGCACGGAAACTCGAGTTTCCGTGCTTATCTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-572s1c1
Sequence:CCGGGCCCTAAAGTTCTTTAAGAATCTCGAGATTCTTAAAGAACTTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-1700s1c1
Sequence:CCGGGCCAGTATTTCCTCTGAGATACTCGAGTATCTCAGAGGAAATACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-1176s1c1
Sequence:CCGGGCCAAGTCACTGTTAAAGTTACTCGAGTAACTTTAACAGTGACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207210.1-271s1c1
Sequence:CCGGGCCATCCTCCAAGAACAAGAACTCGAGTTCTTGTTCTTGGAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks