EMAIL THIS PAGE TO A FRIEND

DYSF

dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)

73 Gene Product Result for
Synonyms: FER1L1 LGMD2B MMD1
Gene ID:
Human(8291) Summary: The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
Mouse(26903) dysferlin
Rat(312492) dysferlin
sheep(101109257) dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
Domestic Rabbit(100342946) dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
naked mole-rat(101715575) dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
Zebrafish(560924) dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
chicken(425353) dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
cow(508157) dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
domestic cat(101099290) dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
dog(483121) dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100636 Anti-DYSF (ab1) antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, bovine, horse, human, guinea pig
western blot pricing
SAB2108117 Anti-DYSF antibody produced in rabbit affinity isolated antibody bovine, rat, horse, rabbit, mouse, human, guinea pig
western blot pricing
HPA017071 Anti-DYSF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA021945 Anti-DYSF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4200388 Anti-Dysferlin (N-terminal region) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human, mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB4200453 Anti-Dysferlin (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, antigen mol wt ~250 kDa mouse, human, rat
dot blot, immunofluorescence, immunohistochemistry pricing
SAB4200387 Anti-Dysferlin antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB4503260 Anti-Dysferlin, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003494 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003494 Rosetta Predictions human pricing
NM_001107869 Rosetta Predictions rat pricing
NM_001077694 Rosetta Predictions mouse pricing
NM_021469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155900 predicted 2009
2 SASI_Hs02_00335774 predicted 2759
3 SASI_Hs01_00155901 predicted 3004
4 SASI_Hs01_00155902 predicted 5710
5 SASI_Hs01_00155903 predicted 4080
6 SASI_Hs01_00155905 predicted 1130
7 SASI_Hs01_00155906 predicted 6567
8 SASI_Hs01_00155907 predicted 1007
9 SASI_Hs01_00155908 predicted 4062
10 SASI_Hs01_00155909 predicted 920
11 SASI_Hs01_00155904 predicted 5959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233085 predicted 1692
2 SASI_Rn02_00233086 predicted 1186
3 SASI_Rn02_00233087 predicted 2659
4 SASI_Rn02_00233088 predicted 1282
5 SASI_Rn02_00233089 predicted 4565
6 SASI_Rn02_00233090 predicted 3044
7 SASI_Rn02_00233091 predicted 2847
8 SASI_Rn02_00233092 predicted 502
9 SASI_Rn02_00233093 predicted 6049
10 SASI_Rn02_00233094 predicted 2754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292882 predicted 1188
2 SASI_Mm02_00292883 predicted 4510
3 SASI_Mm02_00292884 predicted 4257
4 SASI_Mm02_00292885 predicted 5729
5 SASI_Mm02_00292886 predicted 3387
6 SASI_Mm02_00292887 predicted 4418
7 SASI_Mm02_00292888 predicted 1855
8 SASI_Mm02_00292889 predicted 1083
9 SASI_Mm02_00292890 predicted 4744
10 SASI_Mm02_00292891 predicted 3020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326136 predicted 993
2 SASI_Mm02_00326137 predicted 4321
3 SASI_Mm01_00075434 predicted 4059
4 SASI_Mm02_00326138 predicted 5538
5 SASI_Mm02_00326139 predicted 3186
6 SASI_Mm02_00326140 predicted 4221
7 SASI_Mm01_00075437 predicted 1662
8 SASI_Mm02_00326141 predicted 884
9 SASI_Mm02_00326142 predicted 4550
10 SASI_Mm02_00326143 predicted 2826
11 SASI_Mm01_00075431 predicted 5698
12 SASI_Mm01_00075432 predicted 5855
13 SASI_Mm01_00075433 predicted 5468
14 SASI_Mm01_00075435 predicted 1243
15 SASI_Mm01_00075436 predicted 5406
16 SASI_Mm01_00075438 predicted 1612
17 SASI_Mm01_00075439 predicted 1322
18 SASI_Mm01_00075440 predicted 3874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003494
DYSF MISSION shRNA Bacterial Glycerol Stock
dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-5805s1c1
Sequence:CCGGCCTGCGTTGTATTATCTGGAACTCGAGTTCCAGATAATACAACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-3453s1c1
Sequence:CCGGCCCTGCTGAGAAGATGTACTACTCGAGTAGTACATCTTCTCAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003494.x-6841s1c1
Sequence:CCGGGATCAGCTCAGACATATTTCACTCGAGTGAAATATGTCTGAGCTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-5526s1c1
Sequence:CCGGCCGTGTAATGTTTCAGGATAACTCGAGTTATCCTGAAACATTACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-6321s1c1
Sequence:CCGGGCTGGAAATGACCTTGGAGATCTCGAGATCTCCAAGGTCATTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003494.3-5727s21c1
Sequence:CCGGAGATGTGGGTCGACCTATTTCCTCGAGGAAATAGGTCGACCCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003494.3-4579s21c1
Sequence:CCGGCACCGTCAAGGTCATCGATAACTCGAGTTATCGATGACCTTGACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003494.3-3017s21c1
Sequence:CCGGACCTATGAGAACGAGACTAAGCTCGAGCTTAGTCTCGTTCTCATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003494
DYSF MISSION shRNA shRNA Plasmid DNA
dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-5805s1c1
Sequence:CCGGCCTGCGTTGTATTATCTGGAACTCGAGTTCCAGATAATACAACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-3453s1c1
Sequence:CCGGCCCTGCTGAGAAGATGTACTACTCGAGTAGTACATCTTCTCAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003494.x-6841s1c1
Sequence:CCGGGATCAGCTCAGACATATTTCACTCGAGTGAAATATGTCTGAGCTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-5526s1c1
Sequence:CCGGCCGTGTAATGTTTCAGGATAACTCGAGTTATCCTGAAACATTACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-6321s1c1
Sequence:CCGGGCTGGAAATGACCTTGGAGATCTCGAGATCTCCAAGGTCATTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003494.3-5727s21c1
Sequence:CCGGAGATGTGGGTCGACCTATTTCCTCGAGGAAATAGGTCGACCCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003494.3-4579s21c1
Sequence:CCGGCACCGTCAAGGTCATCGATAACTCGAGTTATCGATGACCTTGACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003494.3-3017s21c1
Sequence:CCGGACCTATGAGAACGAGACTAAGCTCGAGCTTAGTCTCGTTCTCATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003494
DYSF MISSION shRNA Lentiviral Transduction Particles
dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-5805s1c1
Sequence:CCGGCCTGCGTTGTATTATCTGGAACTCGAGTTCCAGATAATACAACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-3453s1c1
Sequence:CCGGCCCTGCTGAGAAGATGTACTACTCGAGTAGTACATCTTCTCAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003494.x-6841s1c1
Sequence:CCGGGATCAGCTCAGACATATTTCACTCGAGTGAAATATGTCTGAGCTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-5526s1c1
Sequence:CCGGCCGTGTAATGTTTCAGGATAACTCGAGTTATCCTGAAACATTACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003494.x-6321s1c1
Sequence:CCGGGCTGGAAATGACCTTGGAGATCTCGAGATCTCCAAGGTCATTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003494.3-5727s21c1
Sequence:CCGGAGATGTGGGTCGACCTATTTCCTCGAGGAAATAGGTCGACCCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003494.3-4579s21c1
Sequence:CCGGCACCGTCAAGGTCATCGATAACTCGAGTTATCGATGACCTTGACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003494.3-3017s21c1
Sequence:CCGGACCTATGAGAACGAGACTAAGCTCGAGCTTAGTCTCGTTCTCATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021469
DYSF MISSION shRNA Bacterial Glycerol Stock
dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-1525s1c1
Sequence:CCGGCCCTGCTATGTGAACCTCTATCTCGAGATAGAGGTTCACATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-175s1c1
Sequence:CCGGCCTCTAGATCAGAGCTCAGAACTCGAGTTCTGAGCTCTGATCTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-4767s1c1
Sequence:CCGGCCCTTACATCAAGATCTCCATCTCGAGATGGAGATCTTGATGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-4593s1c1
Sequence:CCGGCGGAGAATTTAAGGGTCTCTTCTCGAGAAGAGACCCTTAAATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-6057s1c1
Sequence:CCGGCCCGTACAAGACCATGAAGTTCTCGAGAACTTCATGGTCTTGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-1430s21c1
Sequence:CCGGACAACGTCAAGCAGATCTTTGCTCGAGCAAAGATCTGCTTGACGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-4916s21c1
Sequence:CCGGAGGAATGCTTGGTCCGTATTTCTCGAGAAATACGGACCAAGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-5801s21c1
Sequence:CCGGTCGTGTTTCCCTTCGACTATCCTCGAGGATAGTCGAAGGGAAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-5120s21c1
Sequence:CCGGAGATCACACTCTACGATTATGCTCGAGCATAATCGTAGAGTGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021469
DYSF MISSION shRNA shRNA Plasmid DNA
dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-1525s1c1
Sequence:CCGGCCCTGCTATGTGAACCTCTATCTCGAGATAGAGGTTCACATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-175s1c1
Sequence:CCGGCCTCTAGATCAGAGCTCAGAACTCGAGTTCTGAGCTCTGATCTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-4767s1c1
Sequence:CCGGCCCTTACATCAAGATCTCCATCTCGAGATGGAGATCTTGATGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-4593s1c1
Sequence:CCGGCGGAGAATTTAAGGGTCTCTTCTCGAGAAGAGACCCTTAAATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-6057s1c1
Sequence:CCGGCCCGTACAAGACCATGAAGTTCTCGAGAACTTCATGGTCTTGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-1430s21c1
Sequence:CCGGACAACGTCAAGCAGATCTTTGCTCGAGCAAAGATCTGCTTGACGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-4916s21c1
Sequence:CCGGAGGAATGCTTGGTCCGTATTTCTCGAGAAATACGGACCAAGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-5801s21c1
Sequence:CCGGTCGTGTTTCCCTTCGACTATCCTCGAGGATAGTCGAAGGGAAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-5120s21c1
Sequence:CCGGAGATCACACTCTACGATTATGCTCGAGCATAATCGTAGAGTGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021469
DYSF MISSION shRNA Lentiviral Transduction Particles
dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-1525s1c1
Sequence:CCGGCCCTGCTATGTGAACCTCTATCTCGAGATAGAGGTTCACATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-175s1c1
Sequence:CCGGCCTCTAGATCAGAGCTCAGAACTCGAGTTCTGAGCTCTGATCTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-4767s1c1
Sequence:CCGGCCCTTACATCAAGATCTCCATCTCGAGATGGAGATCTTGATGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-4593s1c1
Sequence:CCGGCGGAGAATTTAAGGGTCTCTTCTCGAGAAGAGACCCTTAAATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021469.1-6057s1c1
Sequence:CCGGCCCGTACAAGACCATGAAGTTCTCGAGAACTTCATGGTCTTGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-1430s21c1
Sequence:CCGGACAACGTCAAGCAGATCTTTGCTCGAGCAAAGATCTGCTTGACGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-4916s21c1
Sequence:CCGGAGGAATGCTTGGTCCGTATTTCTCGAGAAATACGGACCAAGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-5801s21c1
Sequence:CCGGTCGTGTTTCCCTTCGACTATCCTCGAGGATAGTCGAAGGGAAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021469.2-5120s21c1
Sequence:CCGGAGATCACACTCTACGATTATGCTCGAGCATAATCGTAGAGTGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks