EMAIL THIS PAGE TO A FRIEND

DYTN

dystrotelin

37 Gene Product Result for
UniProtKB ID: A2CJ06
Gene ID:
Mouse(241073) dystrotelin
Rat(100361043) dystrotelin
Zebrafish(563097) dystrotelin
cow(100137960) dystrotelin
Horse(100068627) dystrotelin
dog(100682734) dystrotelin
chicken(429012) dystrotelin
sheep(101105559) dystrotelin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301877 ANTI-DYTN (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001093730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001093730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001093730 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218671 MISSION® esiRNA esiRNA targeting human DYTN human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001093730 Rosetta Predictions human pricing
XM_372969 Rosetta Predictions human pricing
NM_001081658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318133 predicted 1801
2 SASI_Hs02_00318134 predicted 972
3 SASI_Hs02_00318135 predicted 594
4 SASI_Hs02_00318136 predicted 383
5 SASI_Hs02_00318137 predicted 1305
6 SASI_Hs02_00318138 predicted 840
7 SASI_Hs02_00318139 predicted 1148
8 SASI_Hs02_00318140 predicted 1207
9 SASI_Hs02_00318141 predicted 1317
10 SASI_Hs02_00318142 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272283 predicted 290
2 SASI_Hs01_00272284 predicted 249
3 SASI_Hs01_00272285 predicted 264
4 SASI_Hs01_00272286 predicted 235
5 SASI_Hs01_00272287 predicted 219
6 SASI_Hs01_00272288 predicted 365
7 SASI_Hs01_00272289 predicted 251
8 SASI_Hs01_00272290 predicted 283
9 SASI_Hs01_00272291 predicted 301
10 SASI_Hs01_00272292 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298853 predicted 1815
2 SASI_Mm02_00298854 predicted 1062
3 SASI_Mm02_00298855 predicted 338
4 SASI_Mm02_00298856 predicted 1986
5 SASI_Mm02_00298857 predicted 1002
6 SASI_Mm02_00298858 predicted 1240
7 SASI_Mm02_00298859 predicted 880
8 SASI_Mm02_00298860 predicted 1829
9 SASI_Mm02_00298861 predicted 325
10 SASI_Mm02_00298862 predicted 1673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001093730
DYTN MISSION shRNA Bacterial Glycerol Stock
dystrotelin
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-244s21c1
Sequence:CCGGGTCCTACTGCGTCCAAGTTTCCTCGAGGAAACTTGGACGCAGTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-1128s21c1
Sequence:CCGGAGACAAGTTGCAAGCTATATACTCGAGTATATAGCTTGCAACTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-674s21c1
Sequence:CCGGTGTTGAGCCCAGCAATCAAAGCTCGAGCTTTGATTGCTGGGCTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-1547s21c1
Sequence:CCGGTTAGTGCCCTACCCAGTTATCCTCGAGGATAACTGGGTAGGGCACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001093730
DYTN MISSION shRNA shRNA Plasmid DNA
dystrotelin
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-244s21c1
Sequence:CCGGGTCCTACTGCGTCCAAGTTTCCTCGAGGAAACTTGGACGCAGTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-1128s21c1
Sequence:CCGGAGACAAGTTGCAAGCTATATACTCGAGTATATAGCTTGCAACTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-674s21c1
Sequence:CCGGTGTTGAGCCCAGCAATCAAAGCTCGAGCTTTGATTGCTGGGCTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-1547s21c1
Sequence:CCGGTTAGTGCCCTACCCAGTTATCCTCGAGGATAACTGGGTAGGGCACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001093730
DYTN MISSION shRNA Lentiviral Transduction Particles
dystrotelin
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-244s21c1
Sequence:CCGGGTCCTACTGCGTCCAAGTTTCCTCGAGGAAACTTGGACGCAGTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-1128s21c1
Sequence:CCGGAGACAAGTTGCAAGCTATATACTCGAGTATATAGCTTGCAACTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-674s21c1
Sequence:CCGGTGTTGAGCCCAGCAATCAAAGCTCGAGCTTTGATTGCTGGGCTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093730.1-1547s21c1
Sequence:CCGGTTAGTGCCCTACCCAGTTATCCTCGAGGATAACTGGGTAGGGCACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081658
DYTN MISSION shRNA Bacterial Glycerol Stock
dystrotelin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-593s21c1
Sequence:CCGGGACAGAACAGGATCAGGTATTCTCGAGAATACCTGATCCTGTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-709s21c1
Sequence:CCGGGAACAGGAGAGGCGATGATTCCTCGAGGAATCATCGCCTCTCCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-348s21c1
Sequence:CCGGTCTATAGAACAGCCTTCAAATCTCGAGATTTGAAGGCTGTTCTATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-993s21c1
Sequence:CCGGGCAGAACCTTCCCGATCATAGCTCGAGCTATGATCGGGAAGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-370s21c1
Sequence:CCGGACGATCTGTGCAAACTCTTTGCTCGAGCAAAGAGTTTGCACAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081658
DYTN MISSION shRNA shRNA Plasmid DNA
dystrotelin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-593s21c1
Sequence:CCGGGACAGAACAGGATCAGGTATTCTCGAGAATACCTGATCCTGTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-709s21c1
Sequence:CCGGGAACAGGAGAGGCGATGATTCCTCGAGGAATCATCGCCTCTCCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-348s21c1
Sequence:CCGGTCTATAGAACAGCCTTCAAATCTCGAGATTTGAAGGCTGTTCTATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-993s21c1
Sequence:CCGGGCAGAACCTTCCCGATCATAGCTCGAGCTATGATCGGGAAGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-370s21c1
Sequence:CCGGACGATCTGTGCAAACTCTTTGCTCGAGCAAAGAGTTTGCACAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081658
DYTN MISSION shRNA Lentiviral Transduction Particles
dystrotelin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-593s21c1
Sequence:CCGGGACAGAACAGGATCAGGTATTCTCGAGAATACCTGATCCTGTTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-709s21c1
Sequence:CCGGGAACAGGAGAGGCGATGATTCCTCGAGGAATCATCGCCTCTCCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-348s21c1
Sequence:CCGGTCTATAGAACAGCCTTCAAATCTCGAGATTTGAAGGCTGTTCTATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-993s21c1
Sequence:CCGGGCAGAACCTTCCCGATCATAGCTCGAGCTATGATCGGGAAGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081658.1-370s21c1
Sequence:CCGGACGATCTGTGCAAACTCTTTGCTCGAGCAAAGAGTTTGCACAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)