EMAIL THIS PAGE TO A FRIEND

DZANK1

double zinc ribbon and ankyrin repeat domains 1

86 Gene Product Result for
Synonyms: ANKRD64 C20orf12 C20orf84 bA189K21.1 bA189K21.8 dJ568F9.2
Gene ID:
Human(55184) Summary: This gene contains two ankyrin repeat-encoding regions. Ankyrin repeats are tandemly repeated modules of about 33 amino acids described as L-shaped structures consisting of a beta-hairpin and two alpha-helices. Ankyrin repeats occur in a large number of functionally diverse proteins, mainly from eukaryotes, and are known to function as protein-protein interaction domains. Alternative splicing has been observed for this gene but the full-length nature of additional variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(241688) double zinc ribbon and ankyrin repeat domains 1
Zebrafish(407652) double zinc ribbon and ankyrin repeat domains 1
cow(512107) double zinc ribbon and ankyrin repeat domains 1
domestic cat(101081624) double zinc ribbon and ankyrin repeat domains 1
dog(607837) double zinc ribbon and ankyrin repeat domains 1
chicken(416722) double zinc ribbon and ankyrin repeat domains 1
sheep(101121697) double zinc ribbon and ankyrin repeat domains 1
naked mole-rat(101716687) double zinc ribbon and ankyrin repeat domains 1
domestic guinea pig(100725951) double zinc ribbon and ankyrin repeat domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018152 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123591 MISSION® esiRNA esiRNA human C20orf12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099407 Rosetta Predictions human pricing
NM_018152 Rosetta Predictions human pricing
NM_172859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320599 predicted 1465
2 SASI_Hs02_00320600 predicted 1108
3 SASI_Hs02_00320601 predicted 2165
4 SASI_Hs02_00320602 predicted 1213
5 SASI_Hs02_00320603 predicted 1804
6 SASI_Hs02_00320604 predicted 2287
7 SASI_Hs02_00320605 predicted 506
8 SASI_Hs02_00320606 predicted 488
9 SASI_Hs02_00320607 predicted 1491
10 SASI_Hs02_00320608 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023916 predicted 1262
2 SASI_Hs01_00023917 predicted 893
3 SASI_Hs01_00023918 predicted 1568
4 SASI_Hs01_00023919 predicted 1005
5 SASI_Hs01_00023920 predicted 1566
6 SASI_Hs01_00023921 predicted 1962
7 SASI_Hs01_00023922 predicted 990
8 SASI_Hs01_00023923 predicted 1318
9 SASI_Hs01_00023924 predicted 1609
10 SASI_Hs01_00023925 predicted 2089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051166 predicted 1754
2 SASI_Mm02_00344810 predicted 1639
3 SASI_Mm01_00051167 predicted 2132
4 SASI_Mm01_00051168 predicted 1084
5 SASI_Mm01_00051169 predicted 1033
6 SASI_Mm01_00051170 predicted 1071
7 SASI_Mm01_00051171 predicted 2280
8 SASI_Mm01_00051172 predicted 1509
9 SASI_Mm01_00051173 predicted 2333
10 SASI_Mm01_00051174 predicted 239
11 SASI_Mm01_00051175 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018152
DZANK1 MISSION shRNA Bacterial Glycerol Stock
double zinc ribbon and ankyrin repeat domains 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018152.2-2987s1c1
Sequence:CCGGGCAGAGTTAGATATGCACATACTCGAGTATGTGCATATCTAACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-1946s1c1
Sequence:CCGGGCTGTTATGAATAAGCACCATCTCGAGATGGTGCTTATTCATAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018152.2-3109s1c1
Sequence:CCGGCCAACCACACACTGTTCTGTACTCGAGTACAGAACAGTGTGTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018152.2-1474s1c1
Sequence:CCGGCCTCAGGTGTTATGCTCAGAACTCGAGTTCTGAGCATAACACCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018152.2-660s1c1
Sequence:CCGGGCTTCTGTCAAGAATGTGGCTCTCGAGAGCCACATTCTTGACAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-562s1c1
Sequence:CCGGGTGTTTGACAAGCACGGAGATCTCGAGATCTCCGTGCTTGTCAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-925s1c1
Sequence:CCGGGCCTTCATCACAAGAGTCGATCTCGAGATCGACTCTTGTGATGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-1477s1c1
Sequence:CCGGCAGGTGTTATGCTCAGAACAACTCGAGTTGTTCTGAGCATAACACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-1726s1c1
Sequence:CCGGCCAGAGTACCTCAGATACTATCTCGAGATAGTATCTGAGGTACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018152
DZANK1 MISSION shRNA shRNA Plasmid DNA
double zinc ribbon and ankyrin repeat domains 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018152.2-2987s1c1
Sequence:CCGGGCAGAGTTAGATATGCACATACTCGAGTATGTGCATATCTAACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-1946s1c1
Sequence:CCGGGCTGTTATGAATAAGCACCATCTCGAGATGGTGCTTATTCATAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018152.2-3109s1c1
Sequence:CCGGCCAACCACACACTGTTCTGTACTCGAGTACAGAACAGTGTGTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018152.2-1474s1c1
Sequence:CCGGCCTCAGGTGTTATGCTCAGAACTCGAGTTCTGAGCATAACACCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018152.2-660s1c1
Sequence:CCGGGCTTCTGTCAAGAATGTGGCTCTCGAGAGCCACATTCTTGACAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-562s1c1
Sequence:CCGGGTGTTTGACAAGCACGGAGATCTCGAGATCTCCGTGCTTGTCAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-925s1c1
Sequence:CCGGGCCTTCATCACAAGAGTCGATCTCGAGATCGACTCTTGTGATGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-1477s1c1
Sequence:CCGGCAGGTGTTATGCTCAGAACAACTCGAGTTGTTCTGAGCATAACACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-1726s1c1
Sequence:CCGGCCAGAGTACCTCAGATACTATCTCGAGATAGTATCTGAGGTACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018152
DZANK1 MISSION shRNA Lentiviral Transduction Particles
double zinc ribbon and ankyrin repeat domains 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018152.2-2987s1c1
Sequence:CCGGGCAGAGTTAGATATGCACATACTCGAGTATGTGCATATCTAACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-1946s1c1
Sequence:CCGGGCTGTTATGAATAAGCACCATCTCGAGATGGTGCTTATTCATAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018152.2-3109s1c1
Sequence:CCGGCCAACCACACACTGTTCTGTACTCGAGTACAGAACAGTGTGTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018152.2-1474s1c1
Sequence:CCGGCCTCAGGTGTTATGCTCAGAACTCGAGTTCTGAGCATAACACCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018152.2-660s1c1
Sequence:CCGGGCTTCTGTCAAGAATGTGGCTCTCGAGAGCCACATTCTTGACAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-562s1c1
Sequence:CCGGGTGTTTGACAAGCACGGAGATCTCGAGATCTCCGTGCTTGTCAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-925s1c1
Sequence:CCGGGCCTTCATCACAAGAGTCGATCTCGAGATCGACTCTTGTGATGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-1477s1c1
Sequence:CCGGCAGGTGTTATGCTCAGAACAACTCGAGTTGTTCTGAGCATAACACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018152.2-1726s1c1
Sequence:CCGGCCAGAGTACCTCAGATACTATCTCGAGATAGTATCTGAGGTACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172859
DZANK1 MISSION shRNA Bacterial Glycerol Stock
double zinc ribbon and ankyrin repeat domains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172859.1-2893s1c1
Sequence:CCGGCCTCCGAAGTAGCTGAGATTACTCGAGTAATCTCAGCTACTTCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-2147s1c1
Sequence:CCGGGCTGTTGTGAATAAACACTATCTCGAGATAGTGTTTATTCACAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-1360s1c1
Sequence:CCGGGTCCATAACAAGGTTTAGAATCTCGAGATTCTAAACCTTGTTATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-2285s1c1
Sequence:CCGGGCCACTTTACTGGGATGCAATCTCGAGATTGCATCCCAGTAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-890s1c1
Sequence:CCGGCCCATATTTGGCTATCGTCTTCTCGAGAAGACGATAGCCAAATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172859
DZANK1 MISSION shRNA shRNA Plasmid DNA
double zinc ribbon and ankyrin repeat domains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172859.1-2893s1c1
Sequence:CCGGCCTCCGAAGTAGCTGAGATTACTCGAGTAATCTCAGCTACTTCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-2147s1c1
Sequence:CCGGGCTGTTGTGAATAAACACTATCTCGAGATAGTGTTTATTCACAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-1360s1c1
Sequence:CCGGGTCCATAACAAGGTTTAGAATCTCGAGATTCTAAACCTTGTTATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-2285s1c1
Sequence:CCGGGCCACTTTACTGGGATGCAATCTCGAGATTGCATCCCAGTAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-890s1c1
Sequence:CCGGCCCATATTTGGCTATCGTCTTCTCGAGAAGACGATAGCCAAATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172859
DZANK1 MISSION shRNA Lentiviral Transduction Particles
double zinc ribbon and ankyrin repeat domains 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172859.1-2893s1c1
Sequence:CCGGCCTCCGAAGTAGCTGAGATTACTCGAGTAATCTCAGCTACTTCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-2147s1c1
Sequence:CCGGGCTGTTGTGAATAAACACTATCTCGAGATAGTGTTTATTCACAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-1360s1c1
Sequence:CCGGGTCCATAACAAGGTTTAGAATCTCGAGATTCTAAACCTTGTTATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-2285s1c1
Sequence:CCGGGCCACTTTACTGGGATGCAATCTCGAGATTGCATCCCAGTAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172859.1-890s1c1
Sequence:CCGGCCCATATTTGGCTATCGTCTTCTCGAGAAGACGATAGCCAAATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)