EMAIL THIS PAGE TO A FRIEND

DZIP1

DAZ interacting zinc finger protein 1

144 Gene Product Result for
Synonyms: DZIP DZIPt1
Gene ID:
Mouse(66573) DAZ interacting protein 1
Rat(364475) DAZ interacting zinc finger protein 1
domestic guinea pig(100717409) DAZ interacting zinc finger protein 1
naked mole-rat(101709745) DAZ interacting zinc finger protein 1
sheep(101108499) DAZ interacting protein 1
Zebrafish(402875) DAZ interacting zinc finger protein 1
cow(506546) DAZ interacting protein 1
Horse(100059538) DAZ interacting protein 1
chicken(418789) DAZ interacting protein 1
domestic cat(101098678) DAZ interacting protein 1
dog(476964) DAZ interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014934 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU055851 MISSION® esiRNA esiRNA targeting mouse Dzip1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014934 Rosetta Predictions human pricing
NM_198968 Rosetta Predictions human pricing
XM_001053473 Rosetta Predictions rat pricing
XM_001078447 Rosetta Predictions rat pricing
XM_344460 Rosetta Predictions rat pricing
NM_025943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173326 predicted 2472
2 SASI_Hs01_00173328 predicted 1466
3 SASI_Hs02_00346594 predicted 3399
4 SASI_Hs01_00173330 predicted 1799
5 SASI_Hs02_00346595 predicted 1888
6 SASI_Hs01_00173332 predicted 2743
7 SASI_Hs01_00173333 predicted 1496
8 SASI_Hs01_00173334 predicted 1230
9 SASI_Hs02_00346596 predicted 1453
10 SASI_Hs02_00346597 predicted 1804
11 SASI_Hs01_00173327 predicted 3334
12 SASI_Hs01_00173329 predicted 2782
13 SASI_Hs01_00173331 predicted 3143
14 SASI_Hs01_00173335 predicted 2628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152390 predicted 2526
2 SASI_Hs01_00152391 predicted 1461
3 SASI_Hs02_00372480 predicted 1730
4 SASI_Hs02_00372481 predicted 3458
5 SASI_Hs01_00152392 predicted 1792
6 SASI_Hs01_00152395 predicted 2803
7 SASI_Hs01_00152396 predicted 1493
8 SASI_Hs01_00152397 predicted 1236
9 SASI_Hs02_00372482 predicted 2696
10 SASI_Hs01_00152398 predicted 1452
11 SASI_Hs01_00152389 predicted 1850
12 SASI_Hs01_00152393 predicted 1880
13 SASI_Hs01_00152394 predicted 3202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272447 predicted 1657
2 SASI_Rn02_00272448 predicted 1690
3 SASI_Rn02_00272449 predicted 925
4 SASI_Rn02_00272450 predicted 1103
5 SASI_Rn02_00272451 predicted 2512
6 SASI_Rn02_00272452 predicted 1328
7 SASI_Rn02_00272453 predicted 598
8 SASI_Rn02_00272454 predicted 2587
9 SASI_Rn02_00272455 predicted 2282
10 SASI_Rn02_00272456 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360796 predicted 1917
2 SASI_Rn02_00360797 predicted 1956
3 SASI_Rn02_00360798 predicted 1186
4 SASI_Rn02_00360799 predicted 1363
5 SASI_Rn02_00360800 predicted 2765
6 SASI_Rn02_00360801 predicted 1588
7 SASI_Rn02_00360802 predicted 859
8 SASI_Rn02_00360803 predicted 2842
9 SASI_Rn02_00360804 predicted 2535
10 SASI_Rn02_00360805 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397121 predicted 1760
2 SASI_Rn02_00397122 predicted 1795
3 SASI_Rn02_00397123 predicted 1030
4 SASI_Rn02_00397124 predicted 1208
5 SASI_Rn02_00397125 predicted 2615
6 SASI_Rn02_00397126 predicted 1439
7 SASI_Rn02_00397127 predicted 700
8 SASI_Rn02_00397128 predicted 2685
9 SASI_Rn02_00397129 predicted 2384
10 SASI_Rn02_00397130 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091594 predicted 2438
2 SASI_Mm01_00091595 predicted 1884
3 SASI_Mm01_00091596 predicted 1918
4 SASI_Mm02_00329329 predicted 789
5 SASI_Mm01_00091598 predicted 1132
6 SASI_Mm01_00091599 predicted 808
7 SASI_Mm01_00091600 predicted 2134
8 SASI_Mm01_00091601 predicted 1163
9 SASI_Mm02_00329330 predicted 1698
10 SASI_Mm01_00091603 predicted 2696
11 SASI_Mm01_00091597 predicted 1331
12 SASI_Mm01_00091602 predicted 1327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025943
DZIP1 MISSION shRNA Bacterial Glycerol Stock
DAZ interacting zinc finger protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025943.2-3319s1c1
Sequence:CCGGGCCGTTACTAACGAGTTCTTTCTCGAGAAAGAACTCGTTAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-1708s1c1
Sequence:CCGGTGGAACCAATAGAAGAACTTTCTCGAGAAAGTTCTTCTATTGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-1418s1c1
Sequence:CCGGGAAGGATTTAAGTGCAGATAACTCGAGTTATCTGCACTTAAATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-1583s1c1
Sequence:CCGGCCGACAAACACTGGAACCTAACTCGAGTTAGGTTCCAGTGTTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-793s1c1
Sequence:CCGGCCAGCTATTACCAGTGCCATTCTCGAGAATGGCACTGGTAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1388s21c1
Sequence:CCGGCCACATAGAGAAGCTTCGAAGCTCGAGCTTCGAAGCTTCTCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1320s21c1
Sequence:CCGGAGCAAGTGGACAGATCGATTTCTCGAGAAATCGATCTGTCCACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1486s21c1
Sequence:CCGGAGCAGAACGAGCTGATTATCACTCGAGTGATAATCAGCTCGTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1527s21c1
Sequence:CCGGGAATTTGCCAGTAAACCATACCTCGAGGTATGGTTTACTGGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025943
DZIP1 MISSION shRNA shRNA Plasmid DNA
DAZ interacting zinc finger protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025943.2-3319s1c1
Sequence:CCGGGCCGTTACTAACGAGTTCTTTCTCGAGAAAGAACTCGTTAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-1708s1c1
Sequence:CCGGTGGAACCAATAGAAGAACTTTCTCGAGAAAGTTCTTCTATTGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-1418s1c1
Sequence:CCGGGAAGGATTTAAGTGCAGATAACTCGAGTTATCTGCACTTAAATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-1583s1c1
Sequence:CCGGCCGACAAACACTGGAACCTAACTCGAGTTAGGTTCCAGTGTTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-793s1c1
Sequence:CCGGCCAGCTATTACCAGTGCCATTCTCGAGAATGGCACTGGTAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1388s21c1
Sequence:CCGGCCACATAGAGAAGCTTCGAAGCTCGAGCTTCGAAGCTTCTCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1320s21c1
Sequence:CCGGAGCAAGTGGACAGATCGATTTCTCGAGAAATCGATCTGTCCACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1486s21c1
Sequence:CCGGAGCAGAACGAGCTGATTATCACTCGAGTGATAATCAGCTCGTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1527s21c1
Sequence:CCGGGAATTTGCCAGTAAACCATACCTCGAGGTATGGTTTACTGGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025943
DZIP1 MISSION shRNA Lentiviral Transduction Particles
DAZ interacting zinc finger protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025943.2-3319s1c1
Sequence:CCGGGCCGTTACTAACGAGTTCTTTCTCGAGAAAGAACTCGTTAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-1708s1c1
Sequence:CCGGTGGAACCAATAGAAGAACTTTCTCGAGAAAGTTCTTCTATTGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-1418s1c1
Sequence:CCGGGAAGGATTTAAGTGCAGATAACTCGAGTTATCTGCACTTAAATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-1583s1c1
Sequence:CCGGCCGACAAACACTGGAACCTAACTCGAGTTAGGTTCCAGTGTTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025943.2-793s1c1
Sequence:CCGGCCAGCTATTACCAGTGCCATTCTCGAGAATGGCACTGGTAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1388s21c1
Sequence:CCGGCCACATAGAGAAGCTTCGAAGCTCGAGCTTCGAAGCTTCTCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1320s21c1
Sequence:CCGGAGCAAGTGGACAGATCGATTTCTCGAGAAATCGATCTGTCCACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1486s21c1
Sequence:CCGGAGCAGAACGAGCTGATTATCACTCGAGTGATAATCAGCTCGTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025943.2-1527s21c1
Sequence:CCGGGAATTTGCCAGTAAACCATACCTCGAGGTATGGTTTACTGGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014934
VALIDATED
DZIP1 MISSION shRNA Bacterial Glycerol Stock
DAZ interacting zinc finger protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014934.2-3574s1c1
Sequence:CCGGCGAAGCATGTAAAGGTGTTTACTCGAGTAAACACCTTTACATGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014934.2-5687s1c1
Sequence:CCGGCCCTAAATTCTTCGGTGTAATCTCGAGATTACACCGAAGAATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014934.2-1904s1c1
Sequence:CCGGCCAGGATTTCCATAATGTCATCTCGAGATGACATTATGGAAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014934.2-2781s1c1
Sequence:CCGGCCCAGAAAGTCTTCAACTATTCTCGAGAATAGTTGAAGACTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_014934.2-2782s1c1
Sequence:CCGGCCAGAAAGTCTTCAACTATTACTCGAGTAATAGTTGAAGACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014934.2-4889s1c1
Sequence:CCGGGCCACTTTGTTCATTCATTTACTCGAGTAAATGAATGAACAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014934.2-1626s1c1
Sequence:CCGGGCAGTCAGATTCTCCAAGGAACTCGAGTTCCTTGGAGAATCTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014934.2-2031s1c1
Sequence:CCGGCGAACCTCAATGATAGATGATCTCGAGATCATCTATCATTGAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-2175s21c1
Sequence:CCGGCTTTACCTGTAATCCATTAAACTCGAGTTTAATGGATTACAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-2131s21c1
Sequence:CCGGGAGCAGAATGAGCTGATTATACTCGAGTATAATCAGCTCATTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-3797s21c1
Sequence:CCGGGTCGTATCGTAGGCGTTTATACTCGAGTATAAACGCCTACGATACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-1569s21c1
Sequence:CCGGCCGGAGTGAGATCGTCGTATTCTCGAGAATACGACGATCTCACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014934.3-1425s21c1
Sequence:CCGGCGAGGCCAAAGCCAACTATTACTCGAGTAATAGTTGGCTTTGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-2020s21c1
Sequence:CCGGGGTCGGCTCCTGTCACATATACTCGAGTATATGTGACAGGAGCCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014934
VALIDATED
DZIP1 MISSION shRNA shRNA Plasmid DNA
DAZ interacting zinc finger protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014934.2-3574s1c1
Sequence:CCGGCGAAGCATGTAAAGGTGTTTACTCGAGTAAACACCTTTACATGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014934.2-5687s1c1
Sequence:CCGGCCCTAAATTCTTCGGTGTAATCTCGAGATTACACCGAAGAATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014934.2-1904s1c1
Sequence:CCGGCCAGGATTTCCATAATGTCATCTCGAGATGACATTATGGAAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014934.2-2781s1c1
Sequence:CCGGCCCAGAAAGTCTTCAACTATTCTCGAGAATAGTTGAAGACTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_014934.2-2782s1c1
Sequence:CCGGCCAGAAAGTCTTCAACTATTACTCGAGTAATAGTTGAAGACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014934.2-4889s1c1
Sequence:CCGGGCCACTTTGTTCATTCATTTACTCGAGTAAATGAATGAACAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014934.2-1626s1c1
Sequence:CCGGGCAGTCAGATTCTCCAAGGAACTCGAGTTCCTTGGAGAATCTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014934.2-2031s1c1
Sequence:CCGGCGAACCTCAATGATAGATGATCTCGAGATCATCTATCATTGAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-2175s21c1
Sequence:CCGGCTTTACCTGTAATCCATTAAACTCGAGTTTAATGGATTACAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-2131s21c1
Sequence:CCGGGAGCAGAATGAGCTGATTATACTCGAGTATAATCAGCTCATTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-3797s21c1
Sequence:CCGGGTCGTATCGTAGGCGTTTATACTCGAGTATAAACGCCTACGATACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-1569s21c1
Sequence:CCGGCCGGAGTGAGATCGTCGTATTCTCGAGAATACGACGATCTCACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014934.3-1425s21c1
Sequence:CCGGCGAGGCCAAAGCCAACTATTACTCGAGTAATAGTTGGCTTTGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-2020s21c1
Sequence:CCGGGGTCGGCTCCTGTCACATATACTCGAGTATATGTGACAGGAGCCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014934
VALIDATED
DZIP1 MISSION shRNA Lentiviral Transduction Particles
DAZ interacting zinc finger protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014934.2-3574s1c1
Sequence:CCGGCGAAGCATGTAAAGGTGTTTACTCGAGTAAACACCTTTACATGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014934.2-5687s1c1
Sequence:CCGGCCCTAAATTCTTCGGTGTAATCTCGAGATTACACCGAAGAATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014934.2-1904s1c1
Sequence:CCGGCCAGGATTTCCATAATGTCATCTCGAGATGACATTATGGAAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014934.2-2781s1c1
Sequence:CCGGCCCAGAAAGTCTTCAACTATTCTCGAGAATAGTTGAAGACTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_014934.2-2782s1c1
Sequence:CCGGCCAGAAAGTCTTCAACTATTACTCGAGTAATAGTTGAAGACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014934.2-4889s1c1
Sequence:CCGGGCCACTTTGTTCATTCATTTACTCGAGTAAATGAATGAACAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014934.2-1626s1c1
Sequence:CCGGGCAGTCAGATTCTCCAAGGAACTCGAGTTCCTTGGAGAATCTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014934.2-2031s1c1
Sequence:CCGGCGAACCTCAATGATAGATGATCTCGAGATCATCTATCATTGAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-2175s21c1
Sequence:CCGGCTTTACCTGTAATCCATTAAACTCGAGTTTAATGGATTACAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-2131s21c1
Sequence:CCGGGAGCAGAATGAGCTGATTATACTCGAGTATAATCAGCTCATTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-3797s21c1
Sequence:CCGGGTCGTATCGTAGGCGTTTATACTCGAGTATAAACGCCTACGATACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-1569s21c1
Sequence:CCGGCCGGAGTGAGATCGTCGTATTCTCGAGAATACGACGATCTCACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014934.3-1425s21c1
Sequence:CCGGCGAGGCCAAAGCCAACTATTACTCGAGTAATAGTTGGCTTTGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014934.3-2020s21c1
Sequence:CCGGGGTCGGCTCCTGTCACATATACTCGAGTATATGTGACAGGAGCCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks