EMAIL THIS PAGE TO A FRIEND

DZIP1L

DAZ interacting zinc finger protein 1-like

51 Gene Product Result for
Synonyms: DZIP2
UniProtKB ID: Q8IYY4, C9JUG5, Q96M38
Gene ID:
Mouse(72507) DAZ interacting protein 1-like
Rat(315952) DAZ interacting zinc finger protein 1-like
domestic guinea pig(100731407) DAZ interacting zinc finger protein 1-like
naked mole-rat(101706148) DAZ interacting zinc finger protein 1-like
sheep(101112535) DAZ interacting protein 1-like
Domestic Rabbit(100352428) DAZ interacting protein 1-like
Zebrafish(553313) DAZ interacting zinc finger protein 1-like
cow(512800) DAZ interacting zinc finger protein 1-like
Horse(100066729) DAZ interacting protein 1-like
domestic cat(101101584) DAZ interacting protein 1-like
dog(611021) DAZ interacting protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173543 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173543 Rosetta Predictions human pricing
NM_001014095 Rosetta Predictions rat pricing
NM_028258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218229 predicted 2596
2 SASI_Hs01_00218230 predicted 433
3 SASI_Hs02_00368341 predicted 1096
4 SASI_Hs01_00218231 predicted 1779
5 SASI_Hs01_00218232 predicted 2569
6 SASI_Hs01_00218233 predicted 1520
7 SASI_Hs02_00368342 predicted 1126
8 SASI_Hs02_00368343 predicted 1078
9 SASI_Hs01_00218236 predicted 1551
10 SASI_Hs01_00218237 predicted 464
11 SASI_Hs01_00218234 predicted 1344
12 SASI_Hs01_00218235 predicted 2500
13 SASI_Hs01_00218238 predicted 1893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065182 predicted 2061
2 SASI_Rn01_00065183 predicted 1277
3 SASI_Rn01_00065184 predicted 821
4 SASI_Rn01_00065185 predicted 1427
5 SASI_Rn01_00065186 predicted 1767
6 SASI_Rn01_00065187 predicted 616
7 SASI_Rn01_00065188 predicted 623
8 SASI_Rn01_00065189 predicted 2432
9 SASI_Rn01_00065190 predicted 1272
10 SASI_Rn01_00065191 predicted 2002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177955 predicted 2008
2 SASI_Mm01_00177956 predicted 2568
3 SASI_Mm01_00177957 predicted 1474
4 SASI_Mm01_00177958 predicted 1585
5 SASI_Mm02_00333615 predicted 1477
6 SASI_Mm01_00177959 predicted 1799
7 SASI_Mm01_00177960 predicted 661
8 SASI_Mm01_00177961 predicted 2300
9 SASI_Mm01_00177962 predicted 2204
10 SASI_Mm01_00177964 predicted 1321
11 SASI_Mm01_00177963 predicted 2501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028258
DZIP1L MISSION shRNA Bacterial Glycerol Stock
DAZ interacting zinc finger protein 1-like
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028258.3-2603s21c1
Sequence:CCGGGAGACAGACAGAACCTCTATCCTCGAGGATAGAGGTTCTGTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028258.3-2170s21c1
Sequence:CCGGGGAACACTGGTGCAGTCAATTCTCGAGAATTGACTGCACCAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028258.3-3424s1c1
Sequence:CCGGGTTGTGACAAATGGATATTTACTCGAGTAAATATCCATTTGTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028258.3-3180s1c1
Sequence:CCGGCTACCTCTGACCAAGTAATTCCTCGAGGAATTACTTGGTCAGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028258.3-2329s21c1
Sequence:CCGGGACGTGGAGATCTCGTCTTTGCTCGAGCAAAGACGAGATCTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-2402s1c1
Sequence:CCGGCAATATGTTCTTAAGGCCCAACTCGAGTTGGGCCTTAAGAACATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-1029s1c1
Sequence:CCGGCAGCGGGAAATGGAAGCTAAACTCGAGTTTAGCTTCCATTTCCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028258.1-3134s1c1
Sequence:CCGGGCCAGGCATAGTAATCGAGTACTCGAGTACTCGATTACTATGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-1727s1c1
Sequence:CCGGCAAGAGGGACACAAAGGGAATCTCGAGATTCCCTTTGTGTCCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-1159s1c1
Sequence:CCGGCCACGTTAGAAGAGAAACTGACTCGAGTCAGTTTCTCTTCTAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028258.1-1104s1c1
Sequence:CCGGGACAAGCTGAAACAGCTGTTTCTCGAGAAACAGCTGTTTCAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028258
DZIP1L MISSION shRNA shRNA Plasmid DNA
DAZ interacting zinc finger protein 1-like
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028258.3-2603s21c1
Sequence:CCGGGAGACAGACAGAACCTCTATCCTCGAGGATAGAGGTTCTGTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028258.3-2170s21c1
Sequence:CCGGGGAACACTGGTGCAGTCAATTCTCGAGAATTGACTGCACCAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028258.3-3424s1c1
Sequence:CCGGGTTGTGACAAATGGATATTTACTCGAGTAAATATCCATTTGTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028258.3-3180s1c1
Sequence:CCGGCTACCTCTGACCAAGTAATTCCTCGAGGAATTACTTGGTCAGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028258.3-2329s21c1
Sequence:CCGGGACGTGGAGATCTCGTCTTTGCTCGAGCAAAGACGAGATCTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-2402s1c1
Sequence:CCGGCAATATGTTCTTAAGGCCCAACTCGAGTTGGGCCTTAAGAACATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-1029s1c1
Sequence:CCGGCAGCGGGAAATGGAAGCTAAACTCGAGTTTAGCTTCCATTTCCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028258.1-3134s1c1
Sequence:CCGGGCCAGGCATAGTAATCGAGTACTCGAGTACTCGATTACTATGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-1727s1c1
Sequence:CCGGCAAGAGGGACACAAAGGGAATCTCGAGATTCCCTTTGTGTCCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-1159s1c1
Sequence:CCGGCCACGTTAGAAGAGAAACTGACTCGAGTCAGTTTCTCTTCTAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028258.1-1104s1c1
Sequence:CCGGGACAAGCTGAAACAGCTGTTTCTCGAGAAACAGCTGTTTCAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028258
DZIP1L MISSION shRNA Lentiviral Transduction Particles
DAZ interacting zinc finger protein 1-like
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028258.3-2603s21c1
Sequence:CCGGGAGACAGACAGAACCTCTATCCTCGAGGATAGAGGTTCTGTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028258.3-2170s21c1
Sequence:CCGGGGAACACTGGTGCAGTCAATTCTCGAGAATTGACTGCACCAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028258.3-3424s1c1
Sequence:CCGGGTTGTGACAAATGGATATTTACTCGAGTAAATATCCATTTGTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028258.3-3180s1c1
Sequence:CCGGCTACCTCTGACCAAGTAATTCCTCGAGGAATTACTTGGTCAGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028258.3-2329s21c1
Sequence:CCGGGACGTGGAGATCTCGTCTTTGCTCGAGCAAAGACGAGATCTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-2402s1c1
Sequence:CCGGCAATATGTTCTTAAGGCCCAACTCGAGTTGGGCCTTAAGAACATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-1029s1c1
Sequence:CCGGCAGCGGGAAATGGAAGCTAAACTCGAGTTTAGCTTCCATTTCCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028258.1-3134s1c1
Sequence:CCGGGCCAGGCATAGTAATCGAGTACTCGAGTACTCGATTACTATGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-1727s1c1
Sequence:CCGGCAAGAGGGACACAAAGGGAATCTCGAGATTCCCTTTGTGTCCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028258.1-1159s1c1
Sequence:CCGGCCACGTTAGAAGAGAAACTGACTCGAGTCAGTTTCTCTTCTAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028258.1-1104s1c1
Sequence:CCGGGACAAGCTGAAACAGCTGTTTCTCGAGAAACAGCTGTTTCAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173543
DZIP1L MISSION shRNA Bacterial Glycerol Stock
DAZ interacting zinc finger protein 1-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-882s1c1
Sequence:CCGGGACATTCATGAATGCCACCTTCTCGAGAAGGTGGCATTCATGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173543.1-3192s1c1
Sequence:CCGGCCAGCACAAGGTAGTAATCTACTCGAGTAGATTACTACCTTGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-1528s1c1
Sequence:CCGGCAGGAACAAGCTAGGATCATTCTCGAGAATGATCCTAGCTTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-1134s1c1
Sequence:CCGGGCAAGAGTGGACCAAACTTTACTCGAGTAAAGTTTGGTCCACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-1207s1c1
Sequence:CCGGGCCAAGCAGAACTCTACACTACTCGAGTAGTGTAGAGTTCTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-1132s1c1
Sequence:CCGGGAGCAAGAGTGGACCAAACTTCTCGAGAAGTTTGGTCCACTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-973s1c1
Sequence:CCGGCCAGTGGAAGAGGTGTTAGAACTCGAGTTCTAACACCTCTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-867s1c1
Sequence:CCGGCCACCTGTGTGACAAGACATTCTCGAGAATGTCTTGTCACACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173543.1-3213s1c1
Sequence:CCGGGTGACAGAGAACAGGGTGTTACTCGAGTAACACCCTGTTCTCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173543.1-2890s1c1
Sequence:CCGGCCAGGCTTGAGAAAGGGTTAACTCGAGTTAACCCTTTCTCAAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-528s1c1
Sequence:CCGGGCAGGAGAATATTGCTGGCATCTCGAGATGCCAGCAATATTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173543
DZIP1L MISSION shRNA shRNA Plasmid DNA
DAZ interacting zinc finger protein 1-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-882s1c1
Sequence:CCGGGACATTCATGAATGCCACCTTCTCGAGAAGGTGGCATTCATGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173543.1-3192s1c1
Sequence:CCGGCCAGCACAAGGTAGTAATCTACTCGAGTAGATTACTACCTTGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-1528s1c1
Sequence:CCGGCAGGAACAAGCTAGGATCATTCTCGAGAATGATCCTAGCTTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-1134s1c1
Sequence:CCGGGCAAGAGTGGACCAAACTTTACTCGAGTAAAGTTTGGTCCACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-1207s1c1
Sequence:CCGGGCCAAGCAGAACTCTACACTACTCGAGTAGTGTAGAGTTCTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-1132s1c1
Sequence:CCGGGAGCAAGAGTGGACCAAACTTCTCGAGAAGTTTGGTCCACTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-973s1c1
Sequence:CCGGCCAGTGGAAGAGGTGTTAGAACTCGAGTTCTAACACCTCTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-867s1c1
Sequence:CCGGCCACCTGTGTGACAAGACATTCTCGAGAATGTCTTGTCACACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173543.1-3213s1c1
Sequence:CCGGGTGACAGAGAACAGGGTGTTACTCGAGTAACACCCTGTTCTCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173543.1-2890s1c1
Sequence:CCGGCCAGGCTTGAGAAAGGGTTAACTCGAGTTAACCCTTTCTCAAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-528s1c1
Sequence:CCGGGCAGGAGAATATTGCTGGCATCTCGAGATGCCAGCAATATTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173543
DZIP1L MISSION shRNA Lentiviral Transduction Particles
DAZ interacting zinc finger protein 1-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-882s1c1
Sequence:CCGGGACATTCATGAATGCCACCTTCTCGAGAAGGTGGCATTCATGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173543.1-3192s1c1
Sequence:CCGGCCAGCACAAGGTAGTAATCTACTCGAGTAGATTACTACCTTGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-1528s1c1
Sequence:CCGGCAGGAACAAGCTAGGATCATTCTCGAGAATGATCCTAGCTTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-1134s1c1
Sequence:CCGGGCAAGAGTGGACCAAACTTTACTCGAGTAAAGTTTGGTCCACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-1207s1c1
Sequence:CCGGGCCAAGCAGAACTCTACACTACTCGAGTAGTGTAGAGTTCTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-1132s1c1
Sequence:CCGGGAGCAAGAGTGGACCAAACTTCTCGAGAAGTTTGGTCCACTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-973s1c1
Sequence:CCGGCCAGTGGAAGAGGTGTTAGAACTCGAGTTCTAACACCTCTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173543.1-867s1c1
Sequence:CCGGCCACCTGTGTGACAAGACATTCTCGAGAATGTCTTGTCACACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173543.1-3213s1c1
Sequence:CCGGGTGACAGAGAACAGGGTGTTACTCGAGTAACACCCTGTTCTCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173543.1-2890s1c1
Sequence:CCGGCCAGGCTTGAGAAAGGGTTAACTCGAGTTAACCCTTTCTCAAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173543.1-528s1c1
Sequence:CCGGGCAGGAGAATATTGCTGGCATCTCGAGATGCCAGCAATATTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks