EMAIL THIS PAGE TO A FRIEND

DZIP3

DAZ interacting zinc finger protein 3

128 Gene Product Result for
Synonyms: PPP1R66 UURF2 hRUL138
Gene ID:
Mouse(224170) DAZ interacting protein 3, zinc finger
Rat(303963) DAZ interacting zinc finger protein 3
cow(537349) DAZ interacting protein 3, zinc finger
Horse(100061685) DAZ interacting protein 3, zinc finger
domestic cat(101081487) DAZ interacting protein 3, zinc finger
dog(478555) DAZ interacting protein 3, zinc finger
sheep(101116191) DAZ interacting protein 3, zinc finger
naked mole-rat(101709890) DAZ interacting zinc finger protein 3
domestic guinea pig(100729451) DAZ interacting zinc finger protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014648 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001110017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001110017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001110017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014648 Rosetta Predictions human pricing
XM_001058877 Rosetta Predictions rat pricing
XM_221487 Rosetta Predictions rat pricing
NM_001110017 Rosetta Predictions mouse pricing
NM_027341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137201 predicted 2635
2 SASI_Hs01_00137202 predicted 2985
3 SASI_Hs01_00137204 predicted 1696
4 SASI_Hs01_00137206 predicted 3125
5 SASI_Hs01_00137208 predicted 2764
6 SASI_Hs01_00137209 predicted 475
7 SASI_Hs01_00137210 predicted 1529
8 SASI_Hs02_00345973 predicted 1907
9 SASI_Hs02_00345974 predicted 1551
10 SASI_Hs02_00345975 predicted 1228
11 SASI_Hs01_00137203 predicted 464
12 SASI_Hs01_00137205 predicted 1382
13 SASI_Hs01_00137207 predicted 3348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291133 predicted 1852
2 SASI_Rn02_00291134 predicted 658
3 SASI_Rn02_00291135 predicted 3290
4 SASI_Rn02_00291136 predicted 2935
5 SASI_Rn02_00291137 predicted 1465
6 SASI_Rn02_00291138 predicted 1887
7 SASI_Rn02_00291139 predicted 505
8 SASI_Rn02_00291140 predicted 760
9 SASI_Rn02_00291141 predicted 2945
10 SASI_Rn02_00291142 predicted 3083
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380185 predicted 1857
2 SASI_Rn02_00380186 predicted 660
3 SASI_Rn02_00380187 predicted 3283
4 SASI_Rn02_00380188 predicted 2932
5 SASI_Rn02_00380189 predicted 1467
6 SASI_Rn02_00380190 predicted 1886
7 SASI_Rn02_00380191 predicted 510
8 SASI_Rn02_00380192 predicted 764
9 SASI_Rn02_00380193 predicted 2942
10 SASI_Rn02_00380194 predicted 3080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304614 predicted 536
2 SASI_Mm02_00304615 predicted 3114
3 SASI_Mm02_00304616 predicted 560
4 SASI_Mm02_00304617 predicted 2957
5 SASI_Mm02_00304618 predicted 4072
6 SASI_Mm02_00304619 predicted 2968
7 SASI_Mm02_00304620 predicted 2459
8 SASI_Mm02_00304621 predicted 3311
9 SASI_Mm02_00304622 predicted 4016
10 SASI_Mm02_00304623 predicted 3985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331984 predicted 535
2 SASI_Mm02_00331985 predicted 2495
3 SASI_Mm02_00331986 predicted 557
4 SASI_Mm02_00331987 predicted 2336
5 SASI_Mm02_00331988 predicted 3454
6 SASI_Mm02_00331989 predicted 2355
7 SASI_Mm02_00331990 predicted 1843
8 SASI_Mm02_00331991 predicted 2689
9 SASI_Mm02_00331992 predicted 3393
10 SASI_Mm02_00331993 predicted 3362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014648
DZIP3 MISSION shRNA Bacterial Glycerol Stock
DAZ interacting zinc finger protein 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-3347s1c1
Sequence:CCGGCGGAAATTGAAGGATGCTTATCTCGAGATAAGCATCCTTCAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-3108s1c1
Sequence:CCGGCCATACTTACTGTTCCTCAAACTCGAGTTTGAGGAACAGTAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-383s1c1
Sequence:CCGGCCTCACATTAAGAAGTTCTTACTCGAGTAAGAACTTCTTAATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-924s1c1
Sequence:CCGGCGATTTGTAGTTACCTAGATTCTCGAGAATCTAGGTAACTACAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014648.3-1601s21c1
Sequence:CCGGCTATCATCTGCTTCATATAATCTCGAGATTATATGAAGCAGATGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014648.3-1634s21c1
Sequence:CCGGTACTGACATTGTTCGACAAATCTCGAGATTTGTCGAACAATGTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014648
DZIP3 MISSION shRNA shRNA Plasmid DNA
DAZ interacting zinc finger protein 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-3347s1c1
Sequence:CCGGCGGAAATTGAAGGATGCTTATCTCGAGATAAGCATCCTTCAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-3108s1c1
Sequence:CCGGCCATACTTACTGTTCCTCAAACTCGAGTTTGAGGAACAGTAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-383s1c1
Sequence:CCGGCCTCACATTAAGAAGTTCTTACTCGAGTAAGAACTTCTTAATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-924s1c1
Sequence:CCGGCGATTTGTAGTTACCTAGATTCTCGAGAATCTAGGTAACTACAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014648.3-1601s21c1
Sequence:CCGGCTATCATCTGCTTCATATAATCTCGAGATTATATGAAGCAGATGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014648.3-1634s21c1
Sequence:CCGGTACTGACATTGTTCGACAAATCTCGAGATTTGTCGAACAATGTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014648
DZIP3 MISSION shRNA Lentiviral Transduction Particles
DAZ interacting zinc finger protein 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-3347s1c1
Sequence:CCGGCGGAAATTGAAGGATGCTTATCTCGAGATAAGCATCCTTCAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-3108s1c1
Sequence:CCGGCCATACTTACTGTTCCTCAAACTCGAGTTTGAGGAACAGTAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-383s1c1
Sequence:CCGGCCTCACATTAAGAAGTTCTTACTCGAGTAAGAACTTCTTAATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014648.2-924s1c1
Sequence:CCGGCGATTTGTAGTTACCTAGATTCTCGAGAATCTAGGTAACTACAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014648.3-1601s21c1
Sequence:CCGGCTATCATCTGCTTCATATAATCTCGAGATTATATGAAGCAGATGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014648.3-1634s21c1
Sequence:CCGGTACTGACATTGTTCGACAAATCTCGAGATTTGTCGAACAATGTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001110017
DZIP3 MISSION shRNA Bacterial Glycerol Stock
DAZ interacting zinc finger protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110017.1-5586s21c1
Sequence:CCGGTATGCCATTTGTCCATATATACTCGAGTATATATGGACAAATGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-1609s21c1
Sequence:CCGGCTGACATGGTCCGGCAAATATCTCGAGATATTTGCCGGACCATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-1494s21c1
Sequence:CCGGACTGATATTAGACCGAAATTCCTCGAGGAATTTCGGTCTAATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-2016s21c1
Sequence:CCGGGGGATGAAACAAGACGATATTCTCGAGAATATCGTCTTGTTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-530s21c1
Sequence:CCGGTGAGCCTGTTAACGCACTATTCTCGAGAATAGTGCGTTAACAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001110017
DZIP3 MISSION shRNA shRNA Plasmid DNA
DAZ interacting zinc finger protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110017.1-5586s21c1
Sequence:CCGGTATGCCATTTGTCCATATATACTCGAGTATATATGGACAAATGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-1609s21c1
Sequence:CCGGCTGACATGGTCCGGCAAATATCTCGAGATATTTGCCGGACCATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-1494s21c1
Sequence:CCGGACTGATATTAGACCGAAATTCCTCGAGGAATTTCGGTCTAATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-2016s21c1
Sequence:CCGGGGGATGAAACAAGACGATATTCTCGAGAATATCGTCTTGTTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-530s21c1
Sequence:CCGGTGAGCCTGTTAACGCACTATTCTCGAGAATAGTGCGTTAACAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001110017
DZIP3 MISSION shRNA Lentiviral Transduction Particles
DAZ interacting zinc finger protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110017.1-5586s21c1
Sequence:CCGGTATGCCATTTGTCCATATATACTCGAGTATATATGGACAAATGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-1609s21c1
Sequence:CCGGCTGACATGGTCCGGCAAATATCTCGAGATATTTGCCGGACCATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-1494s21c1
Sequence:CCGGACTGATATTAGACCGAAATTCCTCGAGGAATTTCGGTCTAATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-2016s21c1
Sequence:CCGGGGGATGAAACAAGACGATATTCTCGAGAATATCGTCTTGTTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110017.1-530s21c1
Sequence:CCGGTGAGCCTGTTAACGCACTATTCTCGAGAATAGTGCGTTAACAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks